معلومة

كيف يعمل الاقتران الترجمي في بدائيات النوى؟

كيف يعمل الاقتران الترجمي في بدائيات النوى؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

سمعت اليوم عن ظاهرة تسمى "اقتران متعدية" ، حيث تؤثر ترجمة أحد البروتينات على ترجمة بروتين آخر. لا يبدو أن مستويات الرنا المرسال قد تأثرت. كيف يعمل هذا؟ هل هم بحاجة إلى أن يكونوا في نفس المشغل؟


يصف الاقتران الانتقالي في بعض الحالات كيفية قيام الرنا المرسال بتشفير أكثر من بروتين واحد (أي سيكون متعدد الكتل). يُعتقد أن الاقتران الانتقالي يستخدم في الغالب كطريقة لجعل مجموعة من الجينات تترجم بنفس المقدار تقريبًا في الخلية.

الاقتران الانتقالي شائع جدًا في بدائيات النوى ويوجد ما يقرب من نصف جينات إي كولاي في أوبرون متعدد الكتل. ما نعرفه عنهم يكشف. هناك بعض الآليات الفاخرة لضبط نسب هذه الجينات المتجاورة ، والتي لا تزال مقترنة ، ولكن بنسب ليست فقط 1: 1. تبين أن الجينات اللاحقة غالبًا ما تُترجم بتردد أقل إلى حد ما لأن الجينات الأولى متاحة بسرعة أكبر قبل أن يتحلل الرنا المرسال.

كتب إريك ألم @ MIT هذه الورقة البحثية الرائعة حول كيفية تطور الأوبرا.

لقد تمكنت فقط من العثور على هذه الإشارة إلى حالة حقيقية النواة لـ "اقتران متعدية" وهو أمر نادر جدًا ، ولكنه موجود بالفعل. أكثر الحالات شيوعًا للجينات المقترنة متعدية في حقيقيات النوى هي فيروسات الحمض النووي الريبي (RNA) التي تحتوي عادةً على mRNA واحد كامل الطول يرمز لجميع الجينات في الفيروس. إن الضغوط الانتقائية للحفاظ على الجينوم الفيروسي صغيرًا وتقييد نسب هذه الجينات ، ستؤدي إلى تداخل هذه الجينات ، بدءًا من الجين التالي قبل انتهاء الجين الحالي.


الإجابة أعلاه ليست دقيقة تمامًا. صحيح أن الرنا المرسال متعدد الكريات (أي الأوبرا) شائع جدًا في البكتيريا. لكن هذا ليس المقصود بالاقتران متعدية.

يحدث الاقتران الانتقالي عندما لا يكون للجين الثاني لجينين متجاورين في الأوبرون موقع ربط الريبوسوم الخاص به. بدلاً من ذلك ، ينهي الريبوسوم الترجمة عند كودون توقف عند الجين الأول ، ثم يتراجع ببطء ، ويبدأ في ترجمة كودون البداية للجين الثاني. يحدث هذا عندما تتداخل مناطق الترميز للجينين:

على سبيل المثال XXXXXXXXXATGAXXXXXXXXX - السلسلة الأولى من Xs هي نهاية الجين 1 - TGA هو كود الإيقاف للجين 1 - ينزلق الريبوسوم للخلف نيوكليوتيد واحد ويترجم شكل ATG - السلسلة الثانية من XXXX هي منطقة ترميز الجينات الثانية

يقال إن الجينين مرتبطان انتقاليًا لأن الترجمة المشوشة للجين الأول ستلغي ترجمة الجين الثاني.


مراجعة المادة

  • قسم الأحياء الدقيقة وعلم الوراثة الجزيئية ، كلية الطب ، IMRIC ، الجامعة العبرية في القدس ، القدس ، إسرائيل

ترجمة النسخ المقترنة (CTT) هي سمة مميزة للتعبير الجيني بدائية النواة. يحدث CTT عندما ترتبط الريبوسومات بترجمة mRNAs التي لم ينته نسخها بعد ، وبالتالي تشكل مجمعات & # x201CRNAP.mRNA.ribosome & # x201D. CTT هي ظاهرة موثقة جيدًا تشارك في عمليات تنظيم الجينات المهمة ، مثل التوهين وقطبية التشغيل. على الرغم من التقدم في فهمنا للإشارات الخلوية التي تنسق CTT ، إلا أن بعض جوانب بنيتها الجزيئية لا تزال مثيرة للجدل. بالإضافة إلى ذلك ، فإن المعلومات الجديدة حول الفصل المكاني بين آليات النسخ والترجمة في أنواع معينة ، وحول قدرة بعض mRNAs على توطين الترجمة بشكل مستقل ، تتساءل عن الحدوث بالإجماع لـ CTT. علاوة على ذلك ، أظهرت الدراسات التي تم فيها فصل النسخ والترجمة بشكل مصطنع أن استطالة النسخ يمكن أن تستمر بطريقة مستقلة عن الترجمة. هنا ، نراجع الدراسات التي تدعم حدوث CTT والنتائج التي تشكك في مدى انتشاره ، وكذلك نناقش الآليات التي قد تفسر كل من الاقتران وفك الاقتران ، على سبيل المثال ، نقل الكروموسوم وإشراك عناصر cis- أو العابرة ، مثل RNAs الصغيرة و بروتينات ربط الحمض النووي الريبي. تؤثر هذه الآليات على توطين الحمض النووي الريبي واستقراره وترجمته. إن فهم الخيارين اللذين يمكن من خلالهما التعبير عن الجينات وعواقبهما يجب أن يلقي الضوء على طبقة جديدة من التحكم في مصير النسخ البكتيرية.


استطالة

يستلزم الاستطالة دورات متكررة من فك التشفير ، وتشكيل رابطة الببتيد ، والانتقال. يبدأ الاستطالة بمجرد أن يصبح الكودون الثاني لـ ORF متاحًا للقراءة بواسطة elongator aa-tRNAs وينتهي عندما يصل الريبوسوم إلى كودون الإيقاف. الآلية الأساسية للاستطالة متشابهة جدًا في بدائيات النوى وحقيقيات النوى (انظر Dever وآخرون. 2018) ويتم تسهيلها بواسطة عوامل الترجمة المتجانسة (EF-Tu / eEF1A ، EF-G / eEF2 ، EF-P / eIF5A ، SelB / EFsec) ، مع بعض الإضافات البارزة ، مثل eEF3 ، الموجود في الفطريات.

فك

أثناء فك التشفير ، يقوم الريبوسوم بترجمة تسلسل الكودونات في mRNA إلى تسلسل الأحماض الأمينية للبروتين. يتم التعرف على الكودون المكشوف في الموقع A بواسطة aa-tRNAs ، والذي يتم تسليمه في البكتيريا إلى الريبوسوم في مجمع ثلاثي باستخدام EF-Tu و GTP. يحدث التوظيف الأولي لمركب EF-Tu & # x02022GTP / aa-tRNA من خلال التفاعلات مع ساق bL12 للريبوسوم (Kothe et al. 2004 Diaconu et al.2005). يؤدي تفاعل anticodon aa-tRNA مع كودون mRNA في موقع فك تشفير SSU إلى تحلل GTP بواسطة EF-Tu. بعد إطلاق Pi ، يعيد EF-Tu ترتيبه في شكل guanosine diphosphate (GDP) ويطلق الحمض الريبي النووي النقال aa-tRNA. تستوعب aa-tRNA في موقع A من LSU ، بينما تنفصل EF-Tu & # x02022GDP عن الريبوسوم (Rodnina et al. 2017).

تم تحديد هياكل العديد من الوسائط الرئيسية لفك التشفير ، والتي تم تحديدها في البداية من خلال الدراسات البيوكيميائية والفيزيائية الحيوية ، عن طريق الفحص المجهري للالكترونات المبردة (cryo-EM). حاليًا ، يتوفر تسلسل لقطات من فك التشفير المشابه لـ EF-Tu & # x02022GTP / Phe-tRNA Phe (Loveland et al. 2017) و SelB & # x02022GTP / Sec-tRNA Sec (Fischer et al. 2016). على النقيض من EF-Tu ، وهو عامل ترجمة عام يوجه كل مطول aa-tRNA إلى الموقع A ، فإن SelB هو عامل استطالة متخصص مسؤول عن توصيل الحمض الأميني البروتيني الطبيعي رقم 21 ، وهو السيلينوستئين (Forchhammer et al. 1989). في حين أن بنيتي cryo-EM تلتقطان وسائط مختلفة نوعًا ما على مسار فك التشفير ، وتظهر بعض التفاصيل خاصة بـ EF-Tu أو SelB ، فإن التسلسل الإجمالي لإعادة الترتيب متشابه بشكل ملحوظ. يحدد كلا التقريرين (Fischer et al. 2016 Loveland et al. 2017) وسيطًا مبكرًا لفك التشفير حيث يكون المجمع الثلاثي مرتبطًا بوحدة SSU ، لكن anticodon لا يزال زوجًا أساسيًا مع الكودون (الشكل 2). تتمتع هذه الهياكل بتشكيل مفتوح لنطاق SSU مشابه أو حتى أكثر انفتاحًا من الريبوسومات مع موقع A شاغر (Fischer et al. 2016 Loveland et al. 2017). تشكل بقايا الرنا الريباسي 16S النواة المحلية في نقطة مركز فك تشفير SSU بعيدًا عن مجمع الكودون & # x02013anticodon ، على الرغم من أنه يبدو أن هناك اختلافات دقيقة في اتجاه النيوكليوتيدات المختلفة بين هياكل EF-Tu و SelB. في كلا الهيكلين ، توجد البقايا الرئيسية A1492 في النموذج المفتوح & # x0201cflipped-out & # x0201d (Ogle et al. 2001) الموجه بعيدًا عن مجمع codon & # x02013anticodon. A1493 في اتجاه شبه مفتوح في مجمع الريبوسوم & # x02013EF-Tu ، ولكن في اتجاه مفتوح في مجمع SelB ، يبدو أيضًا أن تنقل G530 من 26S rRNA يختلف بين المجمعين (Fischer et al. 2016 Loveland et al. 2017).

الآلية الهيكلية لفك التشفير كما تصورها المجهر الإلكتروني (cryo-EM). (قمة) وسيطة فك التشفير عن طريق عامل الاستطالة (EF) -Tu & # x02022GDP & # x02013Phe-tRNA Phe. (اليسار) رسم تخطيطي للكودون المشابه & # x02013anticodon التفاعل بين كودون UUC mRNA و AAG anticodon لـ Phe-tRNA Phe. تُظهر اللوحات الأخرى وسطاء فك التشفير من الحالة T قبل قراءة الكودون ، A * / T ، حيث تم التعرف على الكودون لكن EF-Tu لم تنتقل إلى حلقة sarcin-ricin (SRL) لحالة SSU و A / T مع الكودون الصحيح & # x02013anticodon التفاعلية و EF-Tu رست على SRL. أقحم تشغيل أعلى إظهار اتجاه المجال G لـ EF-Tu بالنسبة لـ SRL. GCP ، GTP التناظرية غير القابلة للتحلل GDPCP. أقحم في ال قاع إظهار مجمع الكودون & # x02013anticodon والمخلفات الرئيسية لـ 16S ribosomal RNA (rRNA) تتفاعل معها. (وسط) كما هو مذكور أعلاه بالنسبة للزوج القريب مع عدم تطابق G & # x02013U واحد في الموضع الثاني من الكودون & # x02013anticodon complex. (قاع) وسيطة من فك التشفير المشابه بواسطة SelB & # x02022GDPNP / Sec-tRNA Sec. GNP ، GTP التناظري GDPNP IB غير القابل للتحلل ، الارتباط الأولي قبل قراءة الكودون CR ، مجمع قراءة الكودون الذي يأتي فيه anticodon الخاص بـ tRNA بالقرب من الكودون ، ولكن قبل الاقتران الأساسي GA ، معقد تنشيط GTPase مماثل لـ A / تي الدولة. (تم إعداد الشكل باستخدام إحداثيات الهيكل من Fischer et al. 2016 و Loveland et al. 2017 ، PDB 5UYK ، 5UYL ، 5UYM ، 5UYN ، 5UYP ، 5UYQ ، 5LZB ، 5LZC و 5LZD.)

يلتقط الوسيط الثاني لمجمع SelB حالة فك تشفير مبكرة حيث يتم تكوين زوج أساسي واحد فقط بين الكودون و anticodon ، بينما في المركب المرتبط بـ EF-Tu ، يتم إقران anticodon بشكل كامل مع الكودون في كلتا الحالتين ، يبقى الريبوسوم في شكل مفتوح. في مجمع EF-Tu ، يظل جيب ربط GTP بعيدًا عن LSU (Loveland et al. 2017) ، وبالتالي نشاط GTPase لـ EF-Tu ، والذي يتطلب تفاعل EF-Tu مع حلقة sarcin-ricin ( SRL) من 23S rRNA كعنصر تنشيط GTPase ، لا يزال منخفضًا (Maracci et al. 2014). على عكس EF-Tu ، يتفاعل SelB مع LSU في كلا الوسطين قبل التعرف على الكودون ، ولكن الاتصال مع SRL تم حظره بواسطة Sec-tRNA Sec (Fischer et al. 2016). ومن المثير للاهتمام ، أنه تم تحديد تفاعل وقائي مماثل لـ aa-tRNA مع SRL بين وسطاء فك التشفير للترجمة حقيقية النواة ، حيث يمنع وصول eEF1A إلى مركز تنشيط GTPase (Budkevich et al. 2014).

بعد إنشاء تفاعل الكودون & # x02013anticodon ، تغير بقايا الرنا الريباسي 16S في مركز فك التشفير اتجاهها إلى التشكل & # x0201cflipped-in & # x0201d (Ogle et al. 2001) وإغلاقه على مجمع الكودون & # x02013anticodon (Fischer et al. 2016 Loveland et al. 2017) ، بما يتوافق مع الترتيبات المحلية المستخلصة من مقارنات هياكل SSU مع أو بدون حلقات جذعية مضادة للشفرات (ASLs) من موقع A-site tRNA (Ogle et al. 2001). في مجمع EF-Tu ، يبدو أن G530 يعمل كمزلاج يربط الكودون & # x02013anticodon helix في مركز فك التشفير. يتزامن الإغلاق المحلي لمركز فك التشفير مع إغلاق مجال SSU ، والذي يسحب tRNA و EF-Tu نحو SRL. يبدو أن حجم التغييرات المطابقة التي تحدث عند إغلاق المجال (Fischer et al. 2016) أكبر من تلك التي تم الإبلاغ عنها سابقًا لمركب SSU & # x02013ASL (Ogle et al. 2001). يصبح aa-tRNA مشوهًا عند التعرف على الكودون (Valle et al. 2003 Schmeing et al. 2009 Schmeing et al. 2011 Fischer et al. 2016 Loveland et al. 2017). في المحلول ، يمكن أن تتبنى الحمض النووي الريبي (tRNA) مثل هذه المطابقة المشوهة للـ tRNA تلقائيًا خلال أقل من ميكرو ثانية (Fischer et al. 2016). يبدو أن الريبوسوم يعمل على تثبيت مجموعات فرعية محددة من المطابقات في حالة معينة ، اعتمادًا على التفاعلات في مركز فك التشفير. يعمل إرساء المجال G الخاص بـ EF-Tu على تنشيط التحلل المائي لـ GTP ، وهي الخطوة التي لا رجعة فيها والتي تفصل الاختيار الأولي عن خطوة التدقيق اللاحقة.

يعتمد التحلل المائي GTP في EF-Tu و GTPases المترجمة الأخرى على بقاياه المحفوظة عالميًا (His84 in بكتريا قولونية EF-Tu) في منطقة Switch II وعلى بقايا Asp المحفوظة (Asp21 في EF-Tu) في الحلقة P (Maracci et al. 2014). يعمل SRL الخاص بـ LSU كمنشط لـ GTPase (Wool et al. 1992 Schmeing et al. 2009). تفاعل SRL مع His84 يغير pكأ قيمة His84 بطريقة تجعل السلسلة الجانبية مشحونة إيجابياً عند درجة الحموضة المحايدة وتضع جزيء الماء nucleophilic للهجوم على & # x003b3-phosphate لـ GTP (Adamczyk and Warshel 2011 Wallin et al. 2013 Aqvist and Kamerlin 2015) . تفضل عمليات المحاكاة الحاسوبية آلية التفاعل بنقل البروتون المبكر من الماء إلى الفوسفات & # x003b3 ، متبوعًا بهجوم محب للنواة بواسطة أيون هيدروكسيد ، وهو سيناريو يبدو متسقًا مع عدم اعتماد درجة الحموضة في التحلل المائي GTP في أقرب وقت. الأس الهيدروجيني المحايد وتأثير نظير المذيب الحركي ضئيل (Maracci et al. 2014). قد يساهم مجمع Asp21 المحفوظ إلى Mg 2+ في تسريع التحلل المائي GTP عن طريق & # x0201cpushing & # x0201d الشحنة السالبة تجاه His84 (Akvist and Kamerlin 2015). وبالتالي ، فإن التحلل المائي GTP يخضع في المقام الأول للكهرباء الساكنة لمركز التفاعل (Adamczyk and Warshel 2011 Prasad et al. 2013 Maracci et al. 2014 Aqvist and Kamerlin 2015). أيضًا ، يساهم بروتين الريبوسوم bL12 في تنشيط GTPase من خلال آلية لم يتم تحديدها بعد (Mohr et al.2002 Diaconu et al.2005). من المحتمل أن يتم حفظ آلية التحلل المائي GTP في جميع GTPases المترجمة ، مثل EF-Tu و EF-G و SelB و IF2 و RF3 ومثيلاتها حقيقية النواة.

أثناء فك التشفير ، يجب على الريبوسوم أن يختار aa-tRNA cognate إلى الكودون المعطى من مجموعة aa-tRNAs المختلفة. دقة اختيار aa-tRNA عالية ، مع ترددات خطأ تبلغ 10 & # x022123 أو أقل (Drummond and Wilke 2009). أحد الأسئلة المهمة التي لم يتم حلها هو كيف يستجيب الريبوسوم لعدم تطابق الكودون & # x02013anticodon. اقترح النموذج المبكر الذي يعتمد على مقارنة مجمعات 30S & # x02013mRNA مع ASLs المتشابه أو شبه المتشابه أن عدم التطابق يزعج إغلاق مجال SSU (Ogle et al.2002). ومع ذلك ، أظهرت الهياكل البلورية عالية الدقة للريبوسوم غير المتشابه والقريب & # x02013mRNA & # x02013tRNA جميعًا ترتيبًا محليًا وعالميًا متطابقًا لـ SSU (Demeshkina et al. 2012 Rozov et al. 2015 ، 2016a ، b). وبالمثل ، في بنية cryo-EM ، تسببت EF-Tu & # x02022GTP / Lys-tRNA (anticodon UUU ، مما يجعل عدم تطابق الموضع الثاني مع كودون AGA) في إحداث نفس التغييرات التوافقية المحلية والعالمية مثل EF-Tu & # x02022GTP / Phe-tRNA Phe على كودون UUC المشابه (Loveland et al. 2017). ومع ذلك ، فإن جزءًا صغيرًا فقط من المجمعات الثلاثية شبه المتشابهة تتبنى حالة تنشيط GTPase ، في حين يتم رفض الغالبية في مرحلة الاختيار الأولية قبل التحلل المائي GTP (Rodnina et al. 2017). وبالتالي ، من الممكن أن توفر الهياكل المتاحة للمجمعات القريبة لقطات من الأخطاء الترجمية ، بدلاً من وسيطة فك التشفير العادية. تمثل المجمعات المرئية تلك التي اجتازت شاشات اختيار الريبوسوم وستؤدي إلى دمج حمض أميني غير صحيح في البروتين. في المقابل ، قد تكون هياكل الأغلبية المرفوضة للمجمعات القريبة مشابهة لتلك الموجودة في المجمعات قبل اقتران الكودون & # x02013anticodon. والجدير بالذكر أن مثل هذه المجمعات يجب أن تكون أقل استقرارًا من وسيطة التعرف المسبق على الكودون للمجمعات المماثلة ، حيث تبدو عابرة جدًا بحيث لا يمكن التقاطها بواسطة علم البلورات أو cryo-EM. يجب التأكيد على أن هياكل المجمعات شبه المتعارف عليها ذات قيمة عالية ، لأنها توضح كيف يساعد التوحيد أو وجود تعديلات الحمض النووي الريبي في مساعدة المجمعات غير المتطابقة على تبني الهندسة التي يتعرف عليها الريبوسوم على أنها صحيحة.

بعد التحلل المائي GTP وإصدار Pi متأخر قليلاً (Kothe and Rodnina 2006) ، يعيد EF-Tu ترتيبها في التشكل المرتبط بالناتج المحلي الإجمالي. اقترحت المحاكاة الجزيئية الديناميكية أن هذا قد يدفع نهاية aa-tRNA 3 & # x02032 نحو الموقع A على LSU إلى موضع حيث يتفاعل كوع الحمض الريبي النووي النقال مع H89 من LSU (Noel and Whitford 2016). قد يتقلب Aa-tRNA بين الحالتين التوافقيتين حتى يتم تحرير EF-Tu. يشكل وضع نهاية tRNA 3 & # x02032 في الموقع A خطوة منفصلة (Geggier et al. 2010). يتم دعم هذه الفكرة من خلال البيانات البيوكيميائية الحديثة (Ieong et al. 2016 Ranjan and Rodnina 2017) ، على الرغم من أن الخطوتين لم يتم حلهما بشكل حركي لكل الحمض الريبي النووي النقال. تكون الإقامة أبطأ بالنسبة للأقرباء ، مقارنةً بـ aa-tRNA المشابه ، والذي يوفر فرصة ثانية لرفض الحمض الريبي النووي النقال مع وجود عدم تطابق في الكودون & # x02013anticodon المعقدة في مرحلة التدقيق اللغوي (Rodnina et al. 2017).

تشكيل رابطة الببتيد

في مركز peptidyl transferase للريبوسوم ، يتفاعل peptidyl-tRNA في موقع P و aa-tRNA في الموقع A لتشكيل رابطة الببتيد. بالمقارنة مع التفاعل بين ركائز النموذج في المحلول ، يتم تسريع التفاعل على الريبوسوم بمقدار 10 7 أضعاف (Sievers et al. 2004). يتكون الموقع النشط للريبوسوم من الرنا الريباسي (Ban et al. 2000 Polikanov et al. 2014) ، وبالتالي فإن الريبوسوم هو أكبر محفز RNA معروف وهو الريبوزيم الطبيعي المعروف الوحيد الذي له نشاط البوليميراز. على عكس إنزيمات البروتين ، لا يزود الريبوسوم المجموعات المحفزة بـ pكأ القيم عند الأس الهيدروجيني المحايد (Youngman et al. 2004 Bieling et al. 2006). يكون التحفيز بشكل رئيسي غير منتظم (Sievers et al. 2004). يسهل الريبوسوم التفاعل عن طريق طلب جزيئات الماء ، وتحديد مواقع الرنا الريباسي وبقايا الحمض النووي الريبي ، والوقاية الكهروستاتيكية (شارما وآخرون 2005 والين وأكفيست 2010).

يستمر تكوين رابطة الببتيد عن طريق هجوم محب للنيوكليوفيلي للمجموعة الأمينية من aa-tRNA على الكربون الكربوني لرابطة الإستر في peptidyl-tRNA. في المحلول ، من المتوقع أن يحتوي التفاعل على مادتين وسيطتين ، وسيط رباعي السطوح zwitterionic (T & # x000b1) ، يتم فصله ويشكل وسيطًا ثانيًا (T & # x02212) ، ثم يتحلل لتشكيل نواتج التفاعل (Satterthwait و Jencks 1974). أشار تحليل شامل لتأثيرات النظائر الحركية للذرة الثقيلة إلى أن الريبوسوم يغير مسار التفاعل بحيث لا يتراكم الوسيط T & # x000b1. يحدث نقل البروتون من النيتروجين المهاجم وتشكيل الوسيط رباعي السطوح أثناء خطوة تحديد المعدل ، بينما يحدث الانهيار الوسيط رباعي السطوح في خطوة سريعة منفصلة (Hiller et al. 2011). أظهر تحليل تأثيرات نظائر المذيب الحركية أنه في حالة الانتقال المحدود للمعدل ، تتحرك ثلاثة بروتونات بطريقة متضافرة (Kuhlenkoetter et al. 2011).والجدير بالذكر أن هناك العديد من جزيئات الماء داخل مركز ترانسفيراز الببتيدل يمكنها تبادل البروتونات (Polikanov et al. 2014). أيضًا المجموعة 2 & # x02032OH لـ A76 من موقع P-tRNA (Zaher et al. 2011) و 2 & # x02032OH لـ A2451 من 23S rRNA (Erlacher et al. 2006) تساهم في نقل البروتون و / أو تثبيت الشحنات التي تتطور على شكل يستمر رد الفعل.

يوجد حاليًا نموذجان يفسران حركة البروتونات في الموقع النشط أثناء تكوين رابطة الببتيد (الشكل 3). يشير أحد النماذج ، الذي يُشار إليه باسم مكوك البروتون المكون من ثمانية أعضاء (Wallin and Aqvist 2010) ، إلى أن هجوم مجموعة & # x003b1-amino على إستر كربونيل ينتج حالة انتقالية مكونة من ثمانية أعضاء يكون فيها البروتون من & # x003b1-amino يتم استلام المجموعة 2 & # x02032OH من A76 ، والتي في نفس الوقت تتبرع بالبروتون إلى الأكسجين الكربوني عن طريق جزيء ماء مجاور (Kuhlenkoetter et al. 2011). تعد بروتونات 3 & # x02032OH خطوة سريعة مستقلة. يشير النموذج البديل ، المشار إليه باسم & # x0201cproton wire & # x0201d ، إلى أن أحد جزيئات الماء الموجودة في مركز peptidyl transferase مشحون جزئيًا بالقرب من المحطة الأمينية المنبثقة & # x003b1-amino group of ribosomal البروتين bL27 والأكسجين السالب 5 & # x02032-الفوسفات من الموقع A76 (Polikanov et al. 2014). عند تكوين وسيط رباعي السطوح ، قد تنفصل الشحنات الموجبة والسالبة في الفراغ وتنتهي على الجيوب التي تحتوي على جزيئات الماء. يفسر النموذجان تحرك البروتونات الثلاثة بطريقة منسقة في حالة الانتقال المحددة للمعدل ، لكنهما يختلفان حول مسار نقل البروتون الدقيق. إحدى الحجج ضد نموذج سلك البروتون (Polikanov et al. 2014) هي أن حذف bL27 ليس له أي تأثير على تكوين رابطة الببتيد (Maracci et al. 2015). علاوة على ذلك ، لم يتم اختبار دور 2 & # x02032OH لـ A2451 لـ 23S rRNA ، والذي يلعب دورًا أساسيًا في نموذج سلك البروتون ، في ظروف تكوين رابطة الببتيد السريع (Erlacher et al. 2006). من ناحية أخرى ، يحتوي نموذج مكوك البروتون على كيمياء مجسمة أقل مثالية من نموذج سلك البروتون (Polikanov et al. 2014).

نماذج لنقل البروتون أثناء تكوين رابطة الببتيد. يتم عرض مخططات التفاعل لمكوك البروتون المكون من ثمانية أعضاء وآليات سلك البروتون. يظهر P-site tRNA باللون الأخضر ، و tRNA موقع A باللون الأزرق ، و 2 & # x02032OH من A2451 باللون الأسود. يتم تصوير هجوم محبة النواة بواسطة الأسهم الحمراء. في مكوك البروتون المكون من ثمانية أعضاء ، يؤدي هجوم المجموعة & # x003b1-amino على إستر كربونيل إلى حالة انتقالية من ثمانية أعضاء لتقييد المعدل يتم فيها تلقي بروتون من المجموعة الأمينية & # x003b1 2 & # x02032OH لمجموعة A76 ، والتي في نفس الوقت تتبرع بالبروتون الخاص بها إلى الأكسجين الكربوني عبر جزيء ماء مجاور (Kuhlenkoetter et al. 2011). في نموذج سلك البروتون ، يتم تلقي البروتون من المجموعة & # x003b1-amino بواسطة مجموعة 2 & # x02032OH من A76 ، والتي بدورها تتبرع ببروتون إلى 2 & # x02032OH من A2451 ، ثم إلى جزيء الماء (W1) ، والتي تكون سالبة الشحنة جزئيًا (Polikanov et al. 2014). يفسر كلا النموذجين الحركة المنسقة لثلاثة بروتونات في حالة الانتقال المحددة للمعدل (Kuhlenkoetter et al. 2011). (من Polikanov وآخرون. 2014 مقتبس ، بإذن ، من Nature Publishing Group بموجب ترخيص المشاع الإبداعي.)

تختلف تفاعلات الأحماض الأمينية الطبيعية في تفاعل peptidyl transferase اختلافًا كبيرًا (Wohlgemuth et al.2008). ومع ذلك ، يمكن للريبوسوم أن يصنع الببتيدات مع معظم تركيبات الأحماض الأمينية دون مساعدة من أي عوامل مساعدة إضافية. أحد الاستثناءات الملحوظة هو توليف امتدادات poly-Pro مع ثلاثة برولينات متتالية أو أكثر أو متواليات XPPX مميزة مع برولين محاطين بأحماض أمينية محددة (Hersch et al. 2013 Peil et al. 2013 Woolstenhulme et al. 2013). أثناء تخليق مثل هذه الببتيدات ، تتوقف أكشاك الريبوسوم بسبب انخفاض معدل تكوين رابطة الببتيد (على سبيل المثال ، بالنسبة لعنصر PPP ، يتوقف الريبوسوم بعد دمج الإصدار الثاني من Pro) (Ude et al. 2013). يتم التخفيف من المماطلة بواسطة EF-P (Doerfel et al. 2013 Ude et al. 2013) ، وهو عامل ترجمة متخصص يدخل موقع E للريبوسوم ويعمل عن طريق التوجيه الحتمي لركائز موقع P و A تجاههما بشكل تحفيزي. التوجه الإنتاجي في مركز ترانسفيراز الببتيدل (الشكل 4) (Doerfel et al. 2015 Huter et al. 2017). يعمل متماثل حقيقيات النوى لـ EF-P ، eIF5A ، أيضًا على تسريع تكوين سلاسل poly-Pro (Gutierrez et al. 2013). يبدو أن eIF5A له وظائف إضافية في الاستطالة والإنهاء (Schuller et al. 2017 انظر أيضًا Dever et al. 2018). لا تمتلك EF-P مثل هذه الوظيفة الواسعة ، لأن EF-P تتعرف على الحمض الريبي النووي النقال في موقع P وتفضل التفاعلات مع tRNA Pro و tRNA fMet ، ولكنها أقل نشاطًا إلى حد كبير مع tRNAs الأخرى (Katoh et al. 2016).

تأثير عامل الاستطالة P (EF-P) على الريبوسومات المتوقفة عند امتدادات البولي برولين. (أ) تتوقف الريبوسومات أثناء ترجمة البروتينات التي تحتوي على ثلاثة برولينات متتالية (نجوم حمراء). يتم زعزعة استقرار ارتباط peptidyl-tRNA (الأخضر) بموقع P ، والذي (ب) يمكن أن يؤدي إلى انخفاض peptidyl-tRNA. (ج) الكل-عبر او الكل-cis لا يمكن إجراء مطابقة للبولي برولين في السلسلة الوليدة بسبب تصادم ستريكي مع G2061 (رمادي) داخل جدار النفق. يتم زعزعة استقرار Peptidyl-tRNA ويمنع استيعاب الحمض الريبي النووي النقال (البرتقالي) وتكوين الرابطة الببتيدية. (د) يتم التعرف على الريبوسومات المتوقفة على امتدادات البولي برولين بواسطة EF-P (الوردي) ، والتي ترتبط داخل منطقة الموقع الإلكتروني وتثبت الحمض النووي الريبي الببتيديل. يتم تسهيل ربط EF-P عبر جهات الاتصال مع ساق L1 و tRNA موقع P بالإضافة إلى كودون الموقع الإلكتروني. (ه) يعمل تفاعل & # x003b5 (R) - & # x003b2-lysyl-hydroxylysine مع نهاية CCA لـ P-site tRNA Pro على استقرار الحمض النووي الريبي لموقع P بالإضافة إلى السلسلة الناشئة ، عن طريق إجبار البرولين على اعتماد بديل التشكل الذي يمر في نفق خروج الريبوسوم. (F) وهكذا ، يتم تحقيق هندسة مثالية بين السلسلة الوليدة و aminoacyl-tRNA في الموقع A ويمكن أن يحدث تكوين رابطة الببتيد. (من Huter et al. 2017 مقتبس ، بإذن ، من Elsevier & # x000a9 2017.)

تم تعديل EF-P و eIF5A بعد الترجمة (للمراجعة ، انظر Lassak وآخرون. 2016). يعد التعديل ضروريًا للوظيفة (Doerfel et al. 2013 Gutierrez et al. 2013 Ude et al. 2013) ، ولكنه يختلف بين مجموعات مختلفة من البكتيريا وحقيقيات النوى. في بكتريا قولونية، تم تعديل Lys34 من EF-P بعد الترجمة إلى ليسيل ليسين (Yanagisawa et al. 2010). في الزائفة الزنجارية و Shewanella oneidensis Arg32 (التي تحتل منصب بكتريا قولونية Lys34) هو rhamnosylated (Lassak وآخرون. 2015) ، في حين أن EF-P من العصوية الرقيقة يحمل جزء 5-أمينوبنتانول مرتبط بـ Lys32 (Rajkovic et al. 2016). في حقيقيات النوى ، يتم تعديل بقايا اللايسين المحفوظة لـ eIF5A إلى hypusine (Cooper et al. 1983).

النقل

بعد تكوين رابطة الببتيد ، تتحرك الوحدات الفرعية الريبوسومية بالنسبة لبعضها البعض ، من الحالة غير المدورة (N) مع وجود اثنين من الحمض النووي الريبي المرتبط بالموقعين P و A على كل من SSU و LSU ، إلى الحالة المستديرة (R) مع ربط الحمض الريبي النووي الريبي في حالات P / E و A / P. الهجينة. في الوقت نفسه ، ينتقل ساق uL1 من التشكل المفتوح إلى التشكل المغلق نحو الحمض الريبي النووي النقال في موقع P (للمراجعة ، انظر Frank and Gonzalez 2010). تتقلب الريبوسومات في حالة ما قبل الترجمة (PRE) بين حالات N و R. تقترح محاكاة الديناميكيات الجزيئية أن دوران الريبوسوم والحركة الداخلية المصاحبة لمجالات الرأس والجسم SSU (يشار إليها باسم دوران الرأس) هي في جوهرها سريعة جدًا ويمكن أن تحدث في نطاق زمني ميكروثاني (Bock et al. 2013). ومع ذلك ، فإن انتقال الحمض النووي الريبي (tRNA) لا يحدث تلقائيًا لأن تفاعلات اثنين من الحمض النووي الريبي مع الريبوسوم تقيد الحركة. في حالة ما بعد الترجمة (POST) ، تكون الريبوسومات في الغالب في الحالة N مع tRNAs في مواقعها الكلاسيكية.

يتم الترويج للإزاحة بواسطة EF-G بتكلفة التحلل المائي GTP. حركة الحمض الريبي النووي النقال و الرنا المرسال أثناء الإزاحة هي عملية متعددة الخطوات (الشكل 5). تميز النماذج الحالية ما يصل إلى ثماني خطوات منفصلة بناءً على المعلومات الهيكلية بالإضافة إلى الدراسات الحركية للمجموعة وجزيء واحد باستخدام مجموعة كبيرة ومتنوعة من مراسلي التألق وأزواج نقل طاقة الرنين الفلوري (FRET) (Guo and Noller 2012 Adio et al. 2015 Belardinelli et 2016 أ شارما وآخرون 2016 ب واسرمان وآخرون 2016). بالإضافة إلى حالات PRE و POST ، يمكن للريبوسوم أن يتبنى العديد من المطابقات الوسيطة التي تختلف في مواضع tRNAs فيما يتعلق بمجالات الرأس والجسم SSU وحلقات موقع A و P على LSU. ترتبط مواضع tRNA بدرجة دوران الوحدة الفرعية ودوران مجال رأس SSU. يشار إلى هذه الحالات على أنها حالات خيمرية (CHI) (على سبيل المثال ، ap / P و pe / E [Ramrath et al. 2013] ap / ap [Zhou et al. 2014] أو الحالات غير الكنسية المحددة بواسطة smFRET [Chen et al. 2011 Adio وآخرون .2015 Wasserman et al. 2016]).

النموذج الحركي للإزاحة. تتم الإشارة إلى حالات الدوران للوحدة الفرعية الصغيرة (SSU) بالنسبة للوحدة الفرعية الكبيرة (LSU) (الرمادي) من خلال كثافة اللون لجسم SSU (أزرق فاتح للغير مدور ، N أزرق غامق للدوران ، R). يتم تصوير حركات الدوران لرأس SSU بتدرج لوني من اللون الأخضر الفاتح (موضع رأس SSU الكلاسيكي غير القابل للالتواء) إلى أخضر الغابة (أقصى درجة من دوران مجال رأس SSU بالنسبة إلى مجال جسم SSU) (Belardinelli et al. 2016a). يظهر الحمض الريبي النووي الريبي الببتيديل والمنزل في مجمع حالة ما قبل النقل (PRE) باللون الأرجواني والأزرق ، على التوالي. يظهر EF-G (أرجواني) في شكلين ، مضغوط (Lin et al. 2015) وآخر ممتد بعد التعامل مع الريبوسوم (Ramrath et al. 2013 Zhou et al. 2014). معدلات الانتقالات بين PRE (N) و PRE (R) و PRE (N) & # x02013EF-G و PRE (R) & # x02013EF-G (kCW و كCCW عند 37 & # x000b0C) من البيانات في Sharma et al. (2016 ب). ثوابت المعدل للخطوات المحددة حركيًا 1 و 2 و 3 و 4 و 5 مأخوذة من دراسات حركية المجموعة عند 37 & # x000b0C (Belardinelli et al. 2016a). الخطوة 1 ، ربط EF-G. الخطوة 2 ، التحلل المائي GTP (Rodnina وآخرون 1997 Savelsbergh وآخرون 2003) وفتح SSU بسبب الحركات المعاكسة لمجالات الرأس والجسم SSU (انظر أقحم) (بيلاردينيلي وآخرون 2016 أ). الخطوة 3 ، فتح مجمع tRNA & # x02013mRNA على SSU ، والذي يحد من معدل حركة الحمض الريبي النووي النقال وإطلاق Pi من EF-G (Savelsbergh وآخرون 2003). تم إظهار وجود انتقالات سريعة بين الخطوتين 3 و 4 باستخدام وسائط نقل متوقفة (Savelsbergh وآخرون 2003 Holtkamp et al. 2014). تم اعتماد وسائط النقل (CHI1 إلى CHI4) من بيانات smFRET (Adio وآخرون ، 2015). قد تستلزم حالة ما بعد الترجمة (POST) مزيدًا من المحطات الفرعية التوافقية (Wasserman et al. 2016). تشير الخلفية الحمراء الفاتحة إلى أن المجمعات التي تخضع لإلغاء قفل الخلفية الخضراء الفاتحة تظهر مجمعات تتحرك نحو إعادة التخزين. (أقحم) توقيت مميز لحركات عكس اتجاه عقارب الساعة (CCW) واتجاه عقارب الساعة (CW) لجسم SSU بالنسبة إلى LSU (الرموز الزرقاء) ورأس SSU (الرموز الخضراء) (Belardinelli et al. 2016a). (من Belardinelli et al. 2016b بإذن من Taylor & # x00026 Francis وترخيص المجال العام المشاع الإبداعي.)

بعد ارتباط EF-G بالريبوسوم ، تتحرك مجالات رأس وجسم SSU في نفس اتجاه اتجاه عقارب الساعة (CCW) بالنسبة إلى LSU ، والذي يشار إليه بالأمام ، لأنه يتوافق مع اتجاه الانتقال (الشكل 5) ( Guo and Noller 2012 Belardinelli et al. 2016b واسرمان وآخرون 2016). تحلل EF-G GTP ، لكنها تحتفظ بـ Pi (Savelsbergh وآخرون 2003 ، 2005). بعد ذلك ، يبدأ جسم SSU في التحرك للخلف في اتجاه عقارب الساعة (CW) ، بينما يظل رأس SSU في حالة الدوران إلى الأمام (Guo and Noller 2012 Belardinelli et al. 2016b Wasserman et al. 2016). قد يؤدي هذا إلى فتح منطقة فك التشفير بشكل كافٍ لفصل الحمض النووي الريبي عن التفاعلات مع عناصر الريبوسوم التي تحمل mRNA ومضادات الحمض الريبي النووي النقال في موقع A و P ، على التوالي. يوضح هذا كيفية تكوين حالات CHI: بينما يتم الاحتفاظ بمواضع tRNA على مجال رأس SSU ، يتحرك جسم SSU ، مما يؤدي إلى إزاحة الحمض النووي الريبي إلى حالات CHI.

بعد فتح مجمعات الكودون & # x02013anticodon من SSU ، يبدأ مجال رأس SSU في التحرك للخلف (Guo and Noller 2012 Belardinelli et al. 2016b Wasserman et al. 2016). تتبنى الحمض النووي الريبي مواقع POST الكنسية في مواقع P و E وإصدارات EF-G Pi (Savelsbergh وآخرون 2003). بعد ذلك ، يتحرك الحمض الريبي النووي النقال للموقع الإلكتروني بعيدًا عن الحمض الريبي النووي النقال للموقع P ، والذي يصاحبه فقدان كودون الموقع الإلكتروني & # x02013anticodon ، بينما يتحرك رأس SSU إلى الخلف أكثر (Adio et al. 2015 Belardinelli et al. 2016 أ). أخيرًا ، يؤدي تفكك الحمض النووي الريبي لموقع E و EF-G إلى استعادة الحالة N مع وضع P / P الكلاسيكي لل peptidyl-tRNA. يتمثل دور EF-G في تسريع حالة R للريبوسوم وتثبيتها ، وإلغاء تأمين مجمع tRNA & # x02013mRNA من SSU ، ولضمان الحركة الأمامية لـ tRNAs عن طريق إدخال مجال EF-G 4 في موقع A على SSU. بعبارة أخرى ، تعمل EF-G كسقاطة لتصحيح الحركات البراونية للريبوسوم إلى حركة موجهة وتعزز إعادة الترتيب المطابق الرئيسية لـ SSU التي تعطل تفاعلاتها مع tRNAs ، مما يسمح بنقل الحمض الريبي النووي النقال السريع (للمراجعة انظر Belardinelli وآخرون 2016 ب).

النقل وإعادة الترميز

أثناء التحرك على طول mRNA ، قد يواجه الريبوسوم هياكل مثل الحلقات الجذعية أو العقد الكاذبة. في معظم الحالات ، تضمن هليكاز الريبوسوم المكونة من بروتينات الريبوسوم uS3 و uS4 و uS5 فك الرنا المرسال عن طريق مجموعة من آليات الهليكاز النشطة والسلبية (Takyar et al. 2005 Qu et al. 2011). ومع ذلك ، يمكن أن تؤدي عناصر البنية الثانوية لـ mRNA إلى جانب التسلسلات الزلقة إلى & # x020131 Frameshifting. المواقع الزلقة عبارة عن تسلسلات mRNA حيث تكون الكودونات في رمز الإطار 0 و & # x020131 لنفس الحمض الريبي النووي النقال. تشير حركية المجموعة والدراسات أحادية الجزيء إلى أن & # x020131 تغيير الإطارات على ترميز mRNA لبروتين فيروس التهاب الشعب الهوائية المعدي (IBV) 1a / 1b (الذي يعمل في الجسم الحي في كل من الأنظمة حقيقية النواة والبكتيريا [Napthine et al. 2003]) أو الإشريكية القولونية dnaX يحدث أثناء نقل اثنين من الحمض الريبي النووي النقال المتصل بكودونات الموقع الزلق (Caliskan et al. 2014 Chen et al. 2014 Kim et al. 2014 Yan et al. 2015). تم وصف إعادة الترميز في حقيقيات النوى في Dever et al. (2018). عنصر الهيكل الثانوي يزعج ديناميكيات الريبوسوم أثناء النقل. بينما تتقدم الخطوات المبكرة للإزاحة بكفاءة غير مضطربة ، فإن الدوران الخلفي لمجال رأس SSU يعوقه عقبة الهيكل في mRNA (Caliskan et al. 2014 Kim et al. 2014). يبدو أن الريبوسومات المتوقفة في حالة غير مؤمنة أقل صرامة في الحفاظ على إطار القراءة ويمكن أن تنزلق في اتجاه & # x020131.

طي البروتين المتحد

أثناء الاستطالة ، يتحرك الببتيد الناشئ عبر نفق خروج عديد الببتيد من الريبوسوم ، والذي يمتد من مركز ترانسفيراز الببتيدل إلى السطح السيتوبلازمي لـ LSU (الشكل 6). يبلغ طول نفق الخروج حوالي 100 & # x000c5 ويمكن أن يستوعب 30 أو أكثر من الأحماض الأمينية ، اعتمادًا على بنية الببتيد ، قبل ظهور السلسلة الوليدة من الريبوسوم. يمكن أن تبدأ البروتينات الناشئة الناشئة في الطي داخل النفق ، والتي يمكن أن تستوعب عناصر البنية الثانوية أو حتى المجالات الصغيرة (للمراجعات ، انظر Balchin et al. 2016 Rodnina 2016 Thommen et al. 2017). أثناء السفر عبر نفق الخروج ، يمكن أن يتبنى الببتيد هيكلًا مضغوطًا غير أصلي ، والذي يتم إعادة ترتيبه إلى شكل أصلي عندما يخرج النطاق بالكامل من منفذ الخروج (Holtkamp et al. 2015). يؤثر الريبوسوم على طي البروتين من خلال فرض مسار طوي متجهي وعن طريق ربط الطي بوتيرة الترجمة. يتم تقييد أحداث الطي الأولية بالمساحة المحصورة داخل نفق الخروج ويتم تعديلها بشكل أكبر من خلال التفاعلات بين الببتيد الخارج من نفق الخروج وسطح LSU. العلاقة بين معدل الترجمة واتجاه طي البروتين معقدة للغاية. يؤدي وجود الكودونات النادرة في الرنا المرسال إلى إبطاء الترجمة ، ويغير حركية الطي المتحد ، ويغير توزيع مطابقة البروتين في تجمع البروتين الناضج الناتج (Clarke and Clark 2008 Tsai et al.2008 Zhang et al.2009 Siller et al. 2010 Spencer et al. 2012 Yu et al. 2015 Buhr et al. 2016 Sharma et al. 2016a). تشير النمذجة الحاسوبية إلى أن التغييرات في معدل الترجمة يمكن أن تنسق معدلات الطي المحلية وتحفز أو تمنع سوء التشكيل (O & # x02019Brien et al. 2014 Trovato and O & # x02019Brien 2017). يتأثر طي البروتين المتحد أيضًا بالبروتينات التي ترتبط بالقرب من منفذ الخروج ، مثل عامل الزناد المساعد (Gloge et al. 2014 Balchin et al. 2016).

طي البروتين المتحد. تلخص وسائل الشرح التأثيرات المحتملة في كل خطوة (Rodnina 2016). U ، الحالة غير المطوية C ، الحالة المؤقتة المدمجة أو الطي المتوسط ​​N ، الطي الأصلي.


عمليات النسخ المشترك وميزات النسخ التي تؤثر على اقتران الترجمة والنسخ في العتائق

توضح الهياكل التعبيرية التفاعل المنسق للغاية لآليتين جزيئيتين. ومع ذلك ، فإن التعبير السريع ليس معقدًا معزولًا ولكنه يعمل بخصوصية عالية في السيتوبلازم المزدحم حيث تحدث عدد لا يحصى من العمليات الجزيئية في وقت واحد. في العتائق ، تم تحديد عدد من خطوات النسخ والنسخ المشترك التي قد تمنع التحميل الفوري للريبوسوم على الرنا المرسال. من بين أمور أخرى ، قد تؤثر عمليات مثل معالجة الحمض النووي الريبي في النسخ المشترك ، وربط الحمض النووي الريبي غير المشفر (ncRNAs) وربط مرافقي الحمض النووي الريبي وعوامل إنهاء النسخ مع الحمض النووي الريبي ، على التكوين التعبيري وسيتم مناقشته قريبًا في هذا القسم (قارن الأشكال 2G & # x02013 أنا).

يتطلب اقتران الريبوسوم بـ RNAP أن يمتد الرنا المرسال على المسافة بين موقع RNAP النشط وموقع الريبوسوم P لتوفير مساحة كافية لكل من الماكينات (الشكل 2G). عادةً ، يتم ترميز التسلسلات التنظيمية التي تمنح بدء الترجمة في المنطقة غير المترجمة 5 '(5'-UTR). تحتوي بعض mRNAs البدائية على UTR قصير 5 'أو لا شيء على الإطلاق (تم تحليله من أجل هالوفيراكس فولكاني, Thermococcus onnurineus, Pyrococcus abyssi, Saccharolobus solfataricus، Heyer et al.، 2012 Xu et al.، 2012 Beck and Moll، 2018). يتراوح العدد النسبي للـ mRNAs عديم الرائد بين 1.4 و 72٪. يبدو أن آلية التعرف على الرنا المرسال وترابط الريبوسوم متنوعة للغاية في بدائيات النوى ، ولا نعرف ما إذا كانت آلية البدء تؤثر على تكوين التعبيرات وترتبط به (Wen et al. ، 2020). يمكن أيضًا أن تظهر mRNAs التي تفتقر إلى موقع ربط الريبوسوم (RBS) من أحداث معالجة الحمض النووي الريبي في النهاية 5'والتي تؤدي إلى انشقاق 5'-UTR (Qi et al. ، 2017 الشكل 2G). كما هو موضح للعديد من البكتيريا (M & # x000e4der et al. ، 2004 Ramirez-Pe & # x000f1a et al. ، 2010 Lioliou et al. ، 2012) وللكائنات البدائية Methanocaldococcus jannaschii و مارينوباكتر سيلكروفيلوس (Zhang and Olsen ، 2009 Qi et al. ، 2017) ، يمكن أن تؤدي معالجة mRNAs إلى تثبيت النصوص وتنظيم ترجمة البروتينات r (Qi et al. ، 2017) و mRNAs من الأوبرا متعددة الفواصل الإلكترونية. في هذه الحالة ، يبدو أن توقيت معالجة وترجمة الرنا المرسال مهم لتجنب التعارض بين هاتين العمليتين.

الارتباط النسخي المشترك لـ ncRNA التنظيمي الصغير إلى mRNA هو آلية تنظيم شائعة بعد النسخ في بدائيات النوى التي تؤثر على استقرار الحمض النووي الريبي والكفاءة الترجمية لـ mRNAs استجابة للظروف البيئية المتغيرة (Babski et al.، 2014 H & # x000f6r et al.، 2018 ). ل H. volcanii و ميثانوسارسينا مازي تم الكشف عن ncRNAs الصغيرة التي يمكن أن ترتبط بـ 5 'UTR وبالتالي يحتمل إخفاء RBS (J & # x000e4ger et al. ، 2009 Soppa et al. ، 2009 Heyer et al. ، 2012 Gelsinger and DiRuggiero ، 2018 Figure 2H). على سبيل المثال ، الحمض النووي الريبي الصغير41 في م. مازي يربط RBS المتعددة في مرنا متعدد الكواكب ويفصل النسخ والترجمة (Buddeweg et al. ، 2018).

في البكتيريا ، غالبًا ما يتم تهجين ncRNA-mRNA بواسطة RNA chaperone Hfq ، الذي ينتمي إلى عائلة بروتين Sm (Vogel and Luisi ، 2011). يمكن لـ Hfq ربط RNA بالنسخ المشترك (Kambara et al. ، 2018) ويلعب دورًا في إنهاء النسخ / antitermination (Rabhi et al. ، 2011 Sedlyarova et al. ، 2016) ، والتكوين الحيوي للريبوسوم (Andrade et al. ، 2018) و ارتباط الريبوسوم مع الرنا المرسال في البكتيريا (Chen et al. ، 2019). في العتائق ، أ حسن النية نادرا ما يتم ترميز بروتين Hfq. في كثير من الأحيان ، تقوم جينات مفردة أو متعددة بتشفير بروتين شبيه بـ SM (SmAP Reichelt et al. ، 2018). على غرار Hfq البكتيرية ، تبين أن SmAPs الأثرية تربط الحمض النووي الريبي (Nielsen et al. ، 2007 Fischer et al. ، 2010 M & # x000e4rtens et al. ، 2015). ومن ثم ، فإن ارتباط النسخ المشترك لـ ncRNA في 5 'UTR (يحتمل أن يكون مدعومًا بواسطة SmAP) من شأنه أن يمنع ارتباط الريبوسوم بـ 5' UTR (الشكل 2H). أظهرت تجارب الترسيب المناعي المشترك أن SmAPs لا تربط فقط RNAs ولكن أيضًا بروتينات r (Fischer et al. ، 2010). من المتصور أن تشارك SmAPs في تنظيم ما بعد النسخ ، أو الترجمة ، أو تعمل كعامل تجسير لتجنيد الريبوسومات في mRNA (الشكل 2H).

أخيرًا ، قد يكون مسار إنهاء النسخ حاسمًا فيما إذا كان من الممكن حدوث TTC ، أو العكس (الشكل 2I). في العتائق ، ينتهي النسخ عبر آليتان لا يستبعد أحدهما الآخر بالضرورة: (1) إنهاء جوهري عند امتدادات poly (U) (Santangelo and Reeve، 2006 Hirtreiter et al.، 2009، 2010 Santangelo et al.، 2009 Dar et al.، 2016 Berkemer et al. ، 2020) أو (2) الإنهاء المعتمد على العامل بمساعدة عامل الإنهاء الأصلي aCPSF1 / FttA الذي يربط الحمض النووي الريبي الناشئ (Sanders et al. ، 2020 Yue et al. ، 2020). الأهم من ذلك ، يعزز aCPSF1 أيضًا الإنهاء عند امتدادات بولي (U). نهاية عبر يتضمن aCSPF1 انقسام النص في نهاية 3'. في Methanococcus maripaludis أدى حذف aCPSF1 إلى تغيير مستويات التعبير لمعظم الجينات (Yue et al. ، 2020). علاوة على ذلك ، يتم تحفيز الإنهاء المعتمد على aCPSF1 من خلال وجود مجال القصبة و Spt4 / 5 (Sanders et al. ، 2020). على الرغم من أن التفاعل المباشر بين aCPSF1 والساق أو Spt4 / 5 لم يتم التحقق منه بعد بشكل تجريبي ، فمن المحتمل أن يكون التفاعل المادي متسقًا مع كفاءة الإنهاء المتزايدة الملحوظة. من المغري التكهن بأن aCPSF1 والريبوسوم يتفاعلان مع Spt4 / 5 المرتبط بـ RNAP بطريقة حصرية متبادلة مماثلة لـ Rho والريبوسوم مع NusG المرتبط بـ RNAP في البكتيريا. نتيجة لذلك ، قد يكون إنهاء النسخ والاقتران الريبوسوم منفصلين. تقترن الريبوسومات بـ RNAP عبر يمنع Spt4 / 5 تفاعلات aCPSF1 مع الحمض النووي الريبي الناشئ ويمنع الإنهاء المبكر (الشكل 2 ح). بدلاً من ذلك ، بمجرد وصول aCPSF1 إلى Spt4 / 5 ، قد يتداخل مع TTC (الشكل 2H). سيكون هذا بمثابة تذكير بتوظيف Rho بواسطة NusG-KOW إلى RNAP مما يؤدي إلى إنهاء النسخ لنصوص RNA غير المشفرة / غير المترجمة (Washburn et al. ، 2020). ما إذا كان TTC أو الإنهاء السائد يمكن أن يكون خاصًا بالجينات أو العامل ، ويمكن أن يكون هدفًا للتنظيم ، وقد يختلف من نوع إلى نوع. تم عرض تفاعلات مباشرة ومستقلة عن الرنا المرسال بين RNAP البكتيرية والريبوسوم. من المحتمل أنه في بعض الحالات ، على سبيل المثال ، أثناء نسخ mRNAs القصيرة ، قد يربط الريبوسوم الأثري الرنا المرسال بالقرب من قناة خروج RNAP والاتصالات المباشرة بين RNAP المطول والريبوسوم (Wang et al. ، 2020 Webster et al. ، 2020).


كيف يعمل الاقتران الترجمي في بدائيات النوى؟ - مادة الاحياء


العقيدة المركزية في بدائية النواة عكس الخلايا حقيقية النواة

في بدائيات النوى (كائنات بدون غشاء نووي) ، الحمض النووي يتعرض له تكرار و النسخ و RNA يخضع للترجمة في قسم غير مقسم. يمكن أن تحدث جميع العمليات الثلاث في وقت واحد.

في حقيقيات النوى (الكائنات الحية ذات أ الغشاء النووي), الحمض النووي يتعرض له تكرار و النسخ في ال نواة، و البروتينات مصنوعة في السيتوبلازم. RNA لذلك يجب أن يسافر عبر الغشاء النووي قبل أن يخضع للترجمة. هذا يعني ذاك النسخ و ترجمة نكون منفصلين جسديا. النسخة الأولية ، RNA النووي غير المتجانسة (hnRNA ) ، يخضع على نطاق واسع معالجة ما بعد النسخ لعمل رسول RNA (مرنا) جزيء يمكن أن يمر عبر الغشاء النووي.


كيف يعمل الاقتران الترجمي في بدائيات النوى؟ - مادة الاحياء

مقدمةهيكل الجينات

تحتوي الجينات على المعلومات الضرورية لبقاء الخلايا الحية على قيد الحياة والتكاثر. في معظم الكائنات الحية ، تتكون الجينات من الحمض النووي ، حيث يحدد تسلسل الحمض النووي المعين وظيفة الجين. يتم نسخ (نسخ) الجين من الحمض النووي إلى الحمض النووي الريبي ، والذي يمكن أن يكون إما غير مشفر (ncRNA) بوظيفة مباشرة ، أو مرسال وسيط (mRNA) الذي يترجم بعد ذلك إلى بروتين.

يتم التحكم في كل خطوة من هذه الخطوات بواسطة عناصر تسلسل محددة ، أو مناطق ، داخل الجين. كل جين، لذلك ، يتطلب عناصر تسلسل متعددة لتكون وظيفية. [2] يتضمن هذا التسلسل الذي يشفر بالفعل البروتين الوظيفي أو ncRNA ، بالإضافة إلى مناطق التسلسل التنظيمي المتعددة. قد تكون هذه المناطق قصيرة مثل عدد قليل من الأزواج الأساسية ، حتى عدة آلاف من أزواج القواعد الطويلة.
يتشابه الكثير من بنية الجينات على نطاق واسع بين حقيقيات النوى وبدائيات النوى.

هيكل الجينات بدائية النواة

هذه العناصر المشتركة ناتجة إلى حد كبير عن الأصل المشترك للحياة الخلوية في الكائنات الحية منذ أكثر من ملياري سنة. تعكس الاختلافات الرئيسية في بنية الجينات بين حقيقيات النوى وبدائيات النوى آلات النسخ والترجمة المتباينة. فهم بنية الجينات هو أساس فهم شرح الجينات والتعبير والوظيفة

يعد الوصول إلى الرسوم البيانية المتاحة مجانًا أمرًا مهمًا للعلماء والمهن الطبية و عامة الجمهور. 1-4) ، يُظهر عادةً جانبًا واحدًا أو عدة جوانب (على سبيل المثال ، الربط exon ، أو مناطق المحفز). يجب أن تساعد المخططات الغنية بالمعلومات التي تستخدم مخطط ألوان وتخطيط متسقين في فهم المفاهيم المعقدة.

يقدم هذا العمل رسمين بيانيين يلخصان البنية المعقدة ومصطلحات الجينات. يتم تقديم العناصر المشتركة للبنية الجينية في تخطيط وتنسيق متسقين لإبراز العلاقات بين المكونات. الاختلافات الرئيسية بين حقيقيات النوى و بدائيات النوى يشار إلى.
نتائج

ميزات هيكل الجينات المشتركة

هياكل كلا حقيقيات النوى والجينات بدائية النواة تتضمن العديد من عناصر التسلسل المتداخلة. كل عنصر له وظيفة محددة في عملية متعددة الخطوات للتعبير الجيني. تتنوع تسلسلات وأطوال هذه العناصر ، ولكن نفس الوظائف العامة موجودة في معظم الجينات. بالرغم ان الحمض النووي جزيء مزدوج تقطعت به السبل ، عادةً ما يقوم أحد الخيوط فقط بتشفير المعلومات التي يقرأها بوليميراز الحمض النووي الريبي لإنتاج مرنا مشفر للبروتين أو غيرترميز الحمض النووي الريبي. هذا & # 8216sense & # 8217 or & # 8216coding & # 8217 strand ، يعمل في الاتجاه 5 & # 8242 إلى 3 & # 8242 حيث تشير الأرقام إلى ذرات الكربون في العمود الفقري & # 8217s سكر الريبوز. إطار القراءة المفتوح (ORF) من الجين عادة ما يتم تمثيله كسهم يشير إلى الاتجاه الذي يتم فيه قراءة حبلا المعنى

يتضمن هيكل الجينات حقيقية النواة ميزات غير موجودة في بدائيات النوى (شكل 1). تتعلق معظم هذه التعديلات بعد النسخ من ما قبل mRNAs لإنتاج mRNA ناضجة جاهزة للترجمة إلى بروتين. عادةً ما تحتوي الجينات حقيقية النواة على عناصر تنظيمية أكثر للتحكم في التعبير الجيني مقارنة بدائيات النوى. هذا صحيح بشكل خاص في حقيقيات النوى متعددة الخلايا ، البشر على سبيل المثال ، حيث يختلف التعبير الجيني بشكل كبير بين الأنسجة المختلفة.

ما هو جهاز الطرد المركزي

السمة الرئيسية لبنية الجينات حقيقية النواة هي أن نسخها تنقسم عادةً إلى مناطق exon و intron. يتم الاحتفاظ بمناطق إكسون في جزيء الرنا المرسال الناضج النهائي ، بينما يتم تقسيم مناطق الإنترون (مستأصلة) أثناء معالجة ما بعد النسخ. في الواقع ، يمكن أن تكون مناطق intron للجين أطول بكثير من مناطق exon. بمجرد التقسيم معًا ، تشكل الإكسونات منطقة ترميز بروتين واحدة مستمرة ، ولا يمكن اكتشاف حدود لصق. تضيف معالجة ما بعد النسخ حقيقية النواة أيضًا غطاء 5 & # 8242 إلى بداية mRNA وذيل بولي أدينوزين إلى نهاية mRNA. تعمل هذه الإضافات على استقرار الرنا المرسال وتوجيه نقلها من النواة إلى السيتوبلازم ، على الرغم من أن أيا من هذه الميزات غير مشفرة بشكل مباشر في بنية الجين.

عملية الترشيح

بدائيات النوى

يختلف التنظيم العام للجينات بدائية النواة بشكل ملحوظ عن تنظيم حقيقيات النوى (الشكل 2). يتمثل الاختلاف الأكثر وضوحًا في أنه غالبًا ما يتم تجميع ORFs بدائية النواة في ملف مشغل متعدد الكواكب تحت سيطرة مجموعة مشتركة من المتواليات التنظيمية. يتم نسخ جميع ORFs على نفس الرنا المرسال وبالتالي يتم تنظيمها بشكل مشترك وغالبًا ما تؤدي وظائف ذات صلة. [26] [27] عادةً ما يكون لكل ORF موقع ربط الريبوسوم الخاص به (RBS) بحيث تقوم الريبوسومات في نفس الوقت بترجمة ORFs على نفس الرنا المرسال. تعرض بعض المعاملات أيضًا اقتران متعدية ، حيث يتم ربط معدلات الترجمة للعديد من ORFs داخل مشغل. [28] يمكن أن يحدث هذا عندما يظل الريبوسوم مرتبطًا في نهاية ORF وينتقل ببساطة إلى الآخر دون الحاجة إلى RBS جديد. ويلاحظ أيضًا الاقتران الانتقالي عندما تؤثر ترجمة ORF على إمكانية الوصول إلى RBS التالي من خلال التغييرات في RNA الثانوي بنية[30] الحصول على ORFs متعددة على واحد مرنا ممكن فقط في بدائيات النوى لأن النسخ والترجمة تتم في نفس الوقت وفي نفس الموقع الخلوي. [


تسلسل المشغل بجانب المروج هو العنصر التنظيمي الرئيسي في بدائيات النوى. البروتينات المثبطة المرتبطة بتسلسل المشغل تعيق ماديًا إنزيم بوليميريز RNA ، مما يمنع النسخ [32] [33] المحولات الريبية هي تسلسل تنظيمي مهم آخر موجود عادة في UTRs بدائية النواة. تنتقل هذه التسلسلات بين الثانوية البديلة الهياكل في الحمض النووي الريبي اعتمادًا على تركيز المفتاح المستقلبات. الهياكل الثانوية من أي كتلة أو تكشف مناطق تسلسل مهمة مثل RBSs. تعتبر الإنترونات نادرة للغاية في بدائيات النوى ، وبالتالي لا تلعب دورًا مهمًا في تنظيم الجينات بدائية النواة.


كيف يعمل الاقتران الترجمي في بدائيات النوى؟ - مادة الاحياء

C2006 / F2402 '11 ملخص المحاضرة رقم 9

(c) 2011 Dr. Alice Heicklen & amp Dr. Deborah Mowshowitz، Columbia University، New York، NY. آخر تحديث 18/02/2011 09:34 ص.

الصدقات: 9A العناصر التنظيمية وصورة أمبير لجين حقيقي النواة نموذجي (في Word ، وليس pdf)
9B مجمع النسخ واللوائح المعيارية - تم نشر هذه النشرة في الدورات الدراسية

I. كيف تقوم بتشغيل جين حقيقي النواة؟

أ- المشكلة: تحتاج إلى فك / فك الكروماتين قبل أن يصبح النسخ ممكنًا. لا يمكن فقط إضافة بوليميراز الحمض النووي الريبي (وأمبير TFs القاعدية) إلى الحمض النووي وبدء النسخ. الحمض النووي موجود بالكروماتين ويجب إتاحته.

ب. فكيف يمكن أن يحدث النسخ؟

1. تحتاج إلى خطوات متعددة غير موجودة في بدائيات النوى

أ. يجب فك (تفكيك) euchromatin إلى حالة قابلة للنسخ = فضفاض نسبيًا (مقارنة بالكروماتين المغاير ومقارنة بالكروماتين الحقيقي غير النشط). سحب ألياف 30 نانومتر إلى مرحلة الخرز على سلسلة؟

ب. يجب أن ترتبط العديد من عوامل النسخ (TF's) بالحمض النووي أولاً - قبل ربط بوليميراز الحمض النووي الريبي.

ج. يجب أن يرتبط البوليميراز بـ TF's (ليس مباشرة إلى الحمض النووي) للحصول على النسخ الفعلي.

2. ما يغير حالة الكروماتين؟ (لتشديد أو فك.)

أ. إعادة تشكيل البروتينات: هذه مسؤولة عن تحريك و / أو تفكيك النيوكليوسومات. انظر شكل Sadava. 16.19 (14.17). قد تكون هذه مجموعة منفصلة من البروتينات أو الـ TF's التي تنشط الإنزيمات المعدلة.

ب. الإنزيمات التي تعدل ذيول الهيستون. قد يكون للتغييرات في التعديل تأثير مباشر و / أو تؤثر على ارتباط البروتينات المنظمة. بعض الأمثلة:

(1). الفسفرة يحدث H1 في تغيرات M في نشاط الكيناز والفوسفاتيز التي تؤثر على حالة الهيستونات وطي الكروماتين بالتوازي مع التغيرات في اللامينات كما تمت مناقشته في المرة الأخيرة.

(2). أستلة من سلاسل lys الجانبية من الهستونات. أستلة الهستونات & # 8594 كروماتين أكثر نشاطا وأكثر مرونة. يكون أستلة H3 & amp H4 أعلى في الكروماتين النشط.

(3). مثيلة - تعتمد التأثيرات على السلاسل الجانبية للأحماض الأمينية التي يتم فيها ميثيل البروتين - بعض التعديلات تزيد من احتمالية النسخ ، وبعضها يقلل من ذلك. (يمكن ميثلة الحمض النووي أيضًا ، انظر أدناه).

ج. مثيلة من الحمض النووي - في معظم الكائنات الحية ، كلاهما الحمض النووي و يمكن ميثلة الهستونات. (يمكن إضافة مجموعات الميثيل إلى C في الحمض النووي وكذلك السلاسل الجانبية لـ AA.)

عادة ، ولكن ليس دائمًا ، تكون مثيلة الحمض النووي أعلى في الكروماتين غير النشط / المكثف.

في بعض الكائنات الحية ، لا يوجد مثيلة للحمض النووي.

د. "كود" تعديل هيستون الشامل - من الممكن أن يكون لكل مجموعة من التعديلات على ذيول الهيستون معنى محدد. للحصول على شرح كامل (لمعلوماتك) انظر Alberts. (أو اذهب إلى PubMed على http://www.ncbi.nlm.nih.gov/sites/entrez ، وانقر على الكتب في أعلى اليمين ، وأدخل "كود هيستون" في مربع مصطلح البحث.)

3. ما الذي يطلق عملية الشد أو الفك؟ هل يأتي TF أولاً أم يعيد تشكيل / تعديل الإنزيمات؟ النموذج الحالي

أ. يلتزم (المنشطون) التنظيمي أولاً - يؤدي إلى إعادة التصميم والتعديل وما إلى ذلك. يؤدي إلى فك الكروماتين في المنطقة المراد نسخها.

ب. ربط Basal TF's لاحقًا - بعد فك الكروماتين ، يمكن أن ترتبط TF القاعدية (وربما أكثر من TF's التنظيمية) بالحمض النووي ، ويمكن أن يرتبط pol II بـ TF ، ويحدث النسخ.

4. كيف يتناسب هذا مع نتائج حساسية DNase؟

أ. أضعف - المناطق التي ترتبط فيها عوامل النسخ - - تمت إزالة النيوكليوسومات و / أو تخفيفها بشدة = مواقع شديدة الحساسية.

ب. أكثر مرونة - المناطق التي يتم نسخها - تحتوي على نواة بطريقة ما & quot ؛ ليس إزالة.

ج. واسع - المناطق التي لا يتم نسخها - تحتوي على نيوكليوسومات منتظمة ("فضفاضة" ، نسبة إلى الهيتروكروماتين ، ولكنها "ضيقة" أو "ليست فضفاضة جدًا" مقارنةً بالكروماتين الأصلي المنسوخ.) غالبًا ما تكون المناطق التي لم يتم نسخها في كروماتين حقيقي ، وليس في الهيتروكروماتين.


II. تفاصيل النسخ في حقيقيات النوى (مقابل بدائيات النوى) انظر بيكر الفصل 21 ، ص 660-664 (665-670).

أ. المزيد من كل ما هو مطلوب للنسخ في حقيقيات النوى.

1. بوليميراز الحمض النووي الريبي المتعدد (انظر المحاضرة الأخيرة). سنركز على pol II (يجعل mRNA).

2. المزيد من البروتينات - تحتاج TF's ، وليس فقط RNA pol.

3. المزيد من التسلسلات التنظيمية - كثير ديف. تلك التي تربط ديف. TF's

4. نظرة عامة وبعض المصطلحات

  • العنصر التنظيمي المفعول Cis = يؤثر فقط على جزيء الحمض النووي الذي يحدث فيه. عادة ما يكون تسلسل الحمض النووي الذي يربط بعض البروتينات التنظيمية.

  • العنصر التنظيمي العابر = يؤثر على التسلسلات النووية المستهدفة في أي مكان في الخلية. أكواد التسلسل التنظيمي لجزيء تنظيمي - عادة بروتين - يرتبط بهدف - عادة ما يكون تسلسل DNA.

  • يمكن استخدام المصطلح & quottrans act & quot للإشارة إلى الجزيء التنظيمي (عادةً بروتين) أو إلى تسلسل الحمض النووي الذي يرمز إليه.

  • العناصر المؤثرة لرابطة الدول المستقلة = الحمض النووي نفسه = نفسه في جميع خلايا الكائن متعدد الخلايا = هدف الجزيئات التنظيمية المفعول العابرة.

  • الجزيئات التنظيمية المفعول العابرة = منتج DNA = TF & amp ؛ جزيئات أخرى = مختلفة في أنواع مختلفة من الخلايا وفي أوقات مختلفة.

  • في المملكة المتحدة. عدد الأنواع المختلفة من رابطة الدول المستقلة وعناصر التحكم المؤثرة أكبر بكثير من بدائيات النوى. ماذا يحبون؟ انظر أدناه.

  • يمكن أن يكون التنظيم & quot + & quot أو & quot- & quot اعتمادًا على وظيفة البروتين

  • التحكم السلبي - إذا كان البروتين التنظيمي يمنع النسخ.

  • التحكم الإيجابي - إذا كان البروتين التنظيمي يعزز النسخ.

  • إيوك مقابل بروك. - يبدو أن التحكم السلبي (استخدام المكثفات) أكثر شيوعًا في التنفيذ. التحكم الإيجابي (استخدام المنشطات) أكثر شيوعًا في المملكة المتحدة.

  • كيف تفرق بين السيطرة الإيجابية والسلبية - من خلال آثار الحذف.

ب- تفاصيل المواقع التنظيمية (المؤثرة في رابطة الدول المستقلة) في الحمض النووي. بدائيات النوى لها مروجون ومشغلون. ما هي التسلسلات الموجودة في حقيقيات النوى في الحمض النووي التي تؤثر على النسخ؟ (تشير المناقشة التالية في الغالب إلى تنظيم النسخ بواسطة RNA pol II. انظر النصوص على وجه الخصوص بيكر للحصول على تفاصيل حول المروجين وما إلى ذلك للبول الأول والثاني.) انظر Sadava الشكل 16.15 (14.14) أو شكل بيكر 23-21 أو النشرة 9A لهيكل المواقع التنظيمية لجين ترميز بروتيني نموذجي. ثلاثة أنواع من المواقع التنظيمية:

1. المروج الأساسية

أ. الترقيم. عادةً ما يتم حساب موضع القواعد على طول خيط الإحساس من بداية النسخ.

(1). & quotStart & quot = النقطة التي يبدأ فيها النسخ فعليًا (عادةً ما يتم تمييزه بسهم منحني) = صفر.

(2). المنبع والمصب

(أ). المصب = الذهاب نحو نهاية 3 على حبلا الإحساس = في اتجاه النسخ)

(ب). المنبع = الذهاب نحو 5 'نهاية على حبلا الإحساس = في الاتجاه المعاكس من النسخ.

(3). الترقيم - بعض الأمثلة

(أ). +10 = 10 قواعد في اتجاه مجرى النهر من البداية = 10 قواعد بعد بدء النسخ.

(ب). -25 = 25 قاعدة في المنبع من البداية = 25 قاعدة قبل الوصول إلى بداية النسخ.

(ج). +1 = القاعدة الأولى في النسخة التي تحصل على غطاء (قاعدة معدلة متصلة بنهاية 5 ').

(4). الترقيم - متفرقات. الميزات

(أ). لا توجد قاعدة "صفر" ، تمامًا كما لا توجد سنة "صفر" بين BC و AD ولا توجد ساعة صفر بين صباحًا ومساءً.

(ب). في بعض الحالات ، يتم حساب موضع القواعد على طول خيط الإحساس من بداية ترجمة.إذا تم ذلك بهذه الطريقة ، فإن الحرف A في أول AUG هو +1. ومع ذلك ، يُفترض أن يكون الترقيم من بداية النسخما لم يتم ذكر خلاف ذلك.

(ج). ترتبط TF و RNA pol وما إلى ذلك بأخاديد في DNA مزدوج الشريطة ، وليس بضفيرة واحدة. ومع ذلك ، عادةً ما يتم تحديد المواضع في الحمض النووي من حيث خيط الإحساس فقط.هذا لا يعني أن البروتين يرتبط فقط بشريط الإحساس.

ب. المروج الأساسي نفسه يتم تعريف المروج الأساسي بما تحتاجه للسماح لبوليميراز الحمض النووي الريبي بالبدء في المكان الصحيح. ما هو مدرج فيه؟

(1). النقطة الفعلية لبدء النسخ (حيث يكون السهم المنحني) بالإضافة إلى بعض القواعد على جانبي "البداية". يتضمن عادةً بعض القواعد لـ 5 'UTR (منطقة غير مترجمة).

(2). مواقع الربط: الجزء الذي يبدأ فيه ارتباط بوليميراز الرنا والبوليميراز القاعدية - عادةً ما يكون القسم المنبع فقط (قبل) نقطة البداية. غالبًا ما يتضمن تسلسلًا قصيرًا يسمى صندوق TATA (عادةً حوالي 25 قاعدة قبل نقطة البداية).

(3). ميزات إضافية: غالبًا ما يتضمن بعض التسلسلات الإضافية أو المختلفة إلى جانب تلك المحددة. ليس كل مروجي Pol II متماثلون. (إذا كنت مهتمًا بالتفاصيل ، انظر بيكر 21-12 ب (13 ب) ، أو 23-21)

2. عناصر التحكم القريبة. (قريب = قريب).

أ. موقع: بالقرب من المروج الأساسي وبدء النسخ عادةً & quotupstream & quot (على جانب 5 'من بداية النسخ.) يتضمن عادةً عناصر منظم تصل إلى -100 أو -200 (قواعد).

ب. المصطلح: يعتبر أحيانًا جزءًا من المروج الأساسي.

ج. وظيفة: إن ارتباط البروتينات المناسبة يعزز أو يمنع النسخ. تم تحديدها من خلال تأثيرات عمليات الحذف. يختلف تسلسل وآلية العمل.

3. عناصر التحكم البعيدة (البعيد = بعيد)

أ. نوعان: معززات وكواتم للصوت. يمكن أن تقلل عناصر التحكم هذه (كاتمات الصوت) أو تزيد النسخ (المعززات).

ب. يمكن أن تكون هذه بعيدة كل البعد عن الجين الذي يتحكمون فيه (في أي من 5 ' أو 3 'direction = upstream or downstream). يمكن أن يكون في introns أو في مناطق غير مكتوبة.

ج. يمكن أن تعمل في كلا الاتجاهين - قلبهم ليس له أي تأثير ، على عكس مع المروجين. انظر بيكر الشكل. 23-22 (أو النشرة 9 ب).

د. آلية العمل - ربط فريق العمل انظر أدناه.

4. المصطلحات ومتفرقات أمبير. تفاصيل - هذا للإشارة قد لا يتم مناقشته في الفصل.

أ. مربعات = التسلسلات القصيرة الموجودة في المناطق التنظيمية (على سبيل المثال: مربع TATA)

ب. تسلسل الإجماع = تسلسل يحتوي على القاعدة الأكثر شيوعًا الموجودة في كل موضع لجميع التسلسلات من هذا النوع. من المرجح أن تكون أي نسخة فردية من التسلسل مختلفة عن الإجماع في موقف واحد أو أكثر. (مثال: TATAAAA = تسلسل الإجماع لمربع TATA. يعني أن T هي القاعدة الأكثر شيوعًا في الموضع الأول ، A هي الأكثر شيوعًا في الموضع الثاني ، إلخ.)

ج. بالنسبة للكائنات متعددة الخلايا ، لا يتم استخدام المصطلح & الاقتباس & quot لتسلسل الموقع / الحمض النووي حيث يجلس البروتين التنظيمي. لماذا ا؟ لأنه لا يوجد مرنا متعدد الخلايا ولا عوامل تشغيل في حقيقيات النوى الأعلى. (هل بعضها في euk أحادي الخلية.)

ج. كيف تعمل عوامل النسخ القاعدية؟

1. نفس الشيء في جميع الخلايا. مطلوب لبدء النسخ في جميع الخلايا. انظر شكل Sadava. 16.14 (14.13) (14.12) أو شكل بيكر. 21-13 (21-14).

2. خصائص

أ. هناك حاجة إلى العديد من TF القاعدية.

ب. القاعدية TF ل RNA pol. II .

(1). المصطلحات: تسمى Basal TF's للبول II TFIIA ، TFIIB ، إلخ.

(2). الأول هو TFIID ، وهو نفسه يحتوي على العديد من الوحدات الفرعية. الوحدة الفرعية الأكثر دراسة هي TBP (تيATA بإندينغ صبروتين - انظر شكل بيكر. 21-14 (21-15).] يتعرف على صندوق تاتا عندما يكون هناك واحد.

(3). البوليميرات الأخرى لها TF's أيضًا ، لكن TF's للبول II لها أهمية كبيرة ، منذ pol II & # 8594 mRNA

ج. يرتبط Basal TF أولاً بالمحفز الأساسي ، ثم يرتبط بهم RNA pol. يأخذ الكثير من البروتينات للبدء. بوليميراز الحمض النووي الريبي يفعل ليس ترتبط مباشرة بالحمض النووي.

د- كيف يعمل تمويل الإرهاب التنظيمي أو الخاص بالأنسجة؟

1. يتم استخدام أنواع مختلفة في أنواع مختلفة من الخلايا أو في أوقات معينة. ليست كلها مطلوبة في كل الخلايا. انظر بيكر الشكل. 23-24.

2. خصائص

أ. ربط المناطق خارج المروج الأساسي - عادة إلى المعززات أو كاتمات الصوت (عناصر التحكم البعيدة) ولكن أحيانًا لعناصر التحكم القريبة

ب. عندما يكون ارتباط TF التنظيمي ، يمكن أن يقلل أو يعزز النسخ.

(1). المنشطات. يطلق على TF's المنشطات إذا ارتبطت بالمُعزِّزات و / أو تزيد النسخ.

(2). القامعات.تسمى TF's repressors إذا كانت مرتبطة بكواتم الصوت و / أو تقلل النسخ.

ج. كيف يؤثر TF التنظيمي على النسخ: يعتقد أن الحمض النووي يدور حول كاتم الصوت / المحسن قريب من المروج الأساسي. تساعد تقنية TF على المُحسِّن في تثبيت (أو حظر) ارتباط TF القاعدية بشكل مباشر أو غير مباشر بالمروج الأساسي. (انظر شكل بيكر 23-23 أو شكل سادافا 16.15 (14.14) وقسم تمويل الإرهاب التنظيمي أدناه).

د. يوك. مقابل Prok. القامعين - كلا "المكبوتين" يتدخلان في النسخ ، لكن آلية العمل مختلفة.

ه. دور المنشطون - غالبًا ما تسمى البروتينات التي ترتبط بـ TF على المحسن وتؤثر على النسخ (ولكن لا ترتبط مباشرة بالحمض النووي) بالبروتينات المنشط المشترك (أو القامع المشترك). هناك طريقتان يؤثر فيهما المنشطون المشتركون على النسخ:

(1). العمل كوسيط - قم بتوصيل جزأين من آلة النسخ. يرتبط جزء واحد من الوسيط بـ TF (المرتبط بالمُحسِّن أو كاتم الصوت) ويرتبط جزء آخر من الوسيط بعوامل النسخ القاعدية (أو pol II) على المروج الأساسي و / أو عناصر التحكم القريبة. الوسيط = الاسم المعتاد لمجمع المنشطين المشاركين الذين يتصرفون بهذه الطريقة.

(2). تعديل حالة الكروماتين. ربط TF على المحسن وفك الكروماتين في الجين ليتم نسخه. يتم تضمين إعادة تشكيل البروتينات والإنزيمات المعدلة للهيستون في هذه الفئة.

لمراجعة بنية الجينات و TF's ، جرب المسائل 4R-2 و 4R-5A و 4R6-A.

F. تنسيق التحكم. يمكن تشغيل مجموعة من الجينات أو إيقاف تشغيلها مرة واحدة استجابة للإشارة نفسها (صدمة حرارية ، هرمون ، إلخ).

(1). بدائيات النوى مقابل حقيقيات النوى: كلاهما prok. و euk. تظهر تحكمًا منسقًا ، لكن الآلية مختلفة. (انظر الجدول أدناه).

(2). موقع الجينات التي يتم التحكم فيها بشكل منسق

(أ). في بدائيات النوى ، توجد الجينات التي يتم التحكم فيها بشكل منسق معًا في الأوبرونات.

(ب). في حقيقيات النوى ، لا تحتاج الجينات التي يتم التحكم فيها بشكل منسق إلى أن تكون قريبة من بعضها البعض - فقط يجب أن يكون لها نفس عناصر التحكم (المؤثرة). انظر شكل Sadava. 16.17 (14.16).

(3). عناصر التحكم:

(أ). جميع الجينات التي يتم تشغيلها في نفس نوع الخلية و / أو في ظل نفس الظروف تشترك في نفس عناصر التحكم - وبالتالي فإن هذه الجينات جميعها تستجيب لنفس TF's التنظيمي. والنتيجة هي عدة جزيئات من الرنا المرسال ، يتم إجراؤها كلها استجابةً للإشارة (الإشارات) نفسها.

(ب). تحتوي معظم الجينات على عناصر تحكم متعددة (تعمل رابطة الدول المستقلة). لذلك يتأثر نسخ معظم الجينات بأكثر من TF واحد.

(ج). يعتمد نسخ أي جين معين على مجموعات TFs ، وليس واحدًا فقط ، المتوفرة في هذا النوع من الخلايا.

(4). الاختلافات في TF. أنواع الخلايا المختلفة تصنع مختلف أنواع الخلايا التنظيمية. لذلك يتم تشغيل / إيقاف تشغيل مجموعات مختلفة من الجينات التي يتم التحكم فيها بشكل منسق. انظر بيكر الشكل. 23-24.

(5). مقارنة الوضع في بدائيات النوى مقابل حقيقيات النوى متعددة الخلايا:


النتائج

نموذج ميكانيكي للاقتران متعدية في المشغلات البكتيرية

ضع في اعتبارك عاملًا بكتيريًا متعدد السلالات يحتوي على مروج ، ومنطقة غير مترجمة 5 (UTR) ، ومتسلسلان على الأقل لتشفير البروتين (CDS) ، مفصولة بمناطق بين الجينات ، متبوعة بمنتهي النسخ (الشكل 1 أ). يحسب النموذج البيوفيزيائي الكامل معدلات الترجمة لجميع CDS داخل المشغل ، وفقًا لتسلسل 5 ′ UTR ، و CDS والمناطق الجينية. يتم قياس تفاعلات الريبوسوم مع mRNA للتسلسل التعسفي وفقًا لنموذج الطاقة الحرة متعدد المدى الذي تم تطويره مسبقًا (39-41). هنا ، نفترض أن كل CDS قد تم تحسينه بشكل كافٍ بحيث تكون معدلات استطالة الترجمة عالية ، وبالتالي فإن معدلات بدء الترجمة الخاصة بهم هي الخطوة المحددة للمعدل في عملية الترجمة الشاملة. يحتوي النموذج على خمسة معاملات غير معروفة نحددها عن طريق قياس مستويات التعبير لمتغيرات الأوبرا المصممة بشكل عقلاني. لا يأخذ النموذج أيضًا في الحسبان التغييرات في معدل النسخ أو عناصر التسلسل التي يمكن أن تؤثر على استقرار الرنا المرسال ، وبالتالي هناك ثابت التناسب الذي يربط معدلات بدء الترجمة بمستويات التعبير البروتيني.

نموذج ميكانيكي للاقتران متعدية. (أ) ترجمة الاوبرون الثنائي. يُظهر التخطيطي المروج (السهم الأسود) ، (الصندوق الأصفر) 5 ′ UTR ، تسلسل الترميز (الأحمر) المنبع ، المنطقة بين الجينات (الصندوق البرتقالي) ، تسلسل الترميز (الأخضر) المتجه ، و (سداسي) فاصل النسخ . تحتوي المنطقة الجينية على بنية RNA مثبطة ، وتسلسل Shine-Dalgarno (SD) ، وتتابعات تشفير متداخلة. (ب) تحدث إعادة بدء الريبوسوم عندما ينفصل الريبوسوم الممتد عند المنبع ويعاد تجميعه في منطقة بين الجينات ، متبوعًا ببدء الترجمة لتسلسل الترميز النهائي. (ج) يحدث بدء ريبوسوم دي نوفو عندما تتجمع الريبوسومات العصارية الخلوية على الرنا المرسال في المناطق الجينية وتبدأ في ترجمة تسلسل الترميز المصب. (د) يحدد النموذج الفيزيائي الحيوي المقترح للاقتران متعدية التفاعلات الجزيئية التي تتحكم في كل من إعادة بدء الريبوسوم ومعدلات بدء دي نوفو وفقًا لتسلسل الرنا المرسال المدخل. يتم ترميز مكونات النموذج ومنطقة التسلسل المقابلة لها ، بما في ذلك الطاقات الحرة لهياكل الحمض النووي الريبي المثبطة (مقترنة وغير مقترنة) ، والمسافة بين الجينات ، والطاقة الحرة للحالة المرتبطة بالريبوسوم ، ومعدل ترجمة تسلسل الترميز الأولي.

نموذج ميكانيكي للاقتران متعدية. (أ) ترجمة الاوبرون الثنائي. يُظهر التخطيطي المروج (السهم الأسود) ، (الصندوق الأصفر) 5 ′ UTR ، تسلسل الترميز (الأحمر) المنبع ، المنطقة بين الجينات (الصندوق البرتقالي) ، تسلسل الترميز (الأخضر) المتجه ، و (سداسي) فاصل النسخ . تحتوي المنطقة الجينية على بنية RNA مثبطة ، وتسلسل Shine-Dalgarno (SD) ، وتتابعات تشفير متداخلة. (ب) تحدث إعادة بدء الريبوسوم عندما ينفصل الريبوسوم الممتد عند المنبع ويعاد تجميعه في منطقة بين الجينات ، متبوعًا ببدء الترجمة لتسلسل الترميز النهائي. (ج) يحدث بدء ريبوسوم دي نوفو عندما تتجمع الريبوسومات العصارية الخلوية على الرنا المرسال في المناطق الجينية وتبدأ في ترجمة تسلسل الترميز المصب. (د) يحدد النموذج الفيزيائي الحيوي المقترح للاقتران متعدية التفاعلات الجزيئية التي تتحكم في كل من إعادة بدء الريبوسوم ومعدلات بدء دي نوفو وفقًا لتسلسل الرنا المرسال المدخل. يتم ترميز مكونات النموذج ومنطقة التسلسل المقابلة لها ، بما في ذلك الطاقات الحرة لهياكل الحمض النووي الريبي المثبطة (مقترنة وغير مقترنة) ، والمسافة بين الجينات ، والطاقة الحرة للحالة المرتبطة بالريبوسوم ، ومعدل ترجمة تسلسل الترميز الأولي.

بالنسبة للعوامل التي تحتوي على ثلاثة أو أكثر من CDS ، يتم حساب معدلات بدء الترجمة بطريقة متداخلة وتكرارية. باستخدام المعادلة (3) ، يتم حساب معدل إعادة بدء الريبوسوم لـ CDS الثالث ، والذي يعتمد على معدل الترجمة المحسوب لـ CDS الثاني. باستخدام المعادلتين (4) و (5) ، يتم حساب معدل بدء ريبوسوم دي نوفو الثالث CDS ، والذي يعتمد على التسلسل الجيني بين CDS الثاني والثالث بالإضافة إلى معدل الترجمة المحسوب لـ CDS الثاني. تحدد المعادلة (2) معًا معدل بدء ترجمة CDS الثالث. تستمر التكرارات لـ CDSs المتبقية في المشغل.

القياسات الكمية لمعدل إعادة بدء الريبوسوم

قمنا أولاً بقياس مدى إعادة بدء الريبوسوم كميًا ، واعتماده على التسلسل الجيني والمسافة ، من خلال التصميم المنطقي للمناطق الاصطناعية بين الجينات ، والتحكم في معدلات الترجمة الأولية ، وقياس الترجمة النهائية في نظام مراسل ثنائي الموجات mRFP1 و GFPmut3b ( الشكل 2 أ). تم إنشاء أحد عشر منطقة بين الجينات وإدخالها في أوبرون ثنائي الموجات مع مسافات بين الجينات تختلف من د12 = −25 (5′-أغسطسCCGCAGUAUACCGGUCAAGUAA-3 ′) إلى د12 = 25 (5′- UAACAUACGUAUCCCACAUCCCACACAUأغسطس-3 ′). تم تصميم هذه المناطق بين الجينات لتقليل المصدر الآخر للاقتران متعدية ، ومعدل بدء الريبوسوم de novo ، عن طريق منع تكوين هياكل mRNA والتأكد من أن الوحدة الفرعية الريبوزومية 30S مرتبطة بشكل سيء بموقع ربط الريبوسوم CDS في المصب ، كما هو محدد كميًا بنسبة عالية. Δجيالمجموع الطاقة الحرة (انخفاض تقارب الريبوسوم). قمنا بعد ذلك بتصميم اثنين من تسلسل موقع ربط الريبوسوم الاصطناعي الذي يتحكم في تعبير mRFP1 بمعدلات ترجمة تبلغ 10 و 94000 وحدة دولية على المقياس التناسبي لـ RBS Calculator.

قياس ونمذجة معدلات إعادة بدء الريبوسوم. (أ) تُحسب المسافة بين الجينات وفقًا لمواقف كودونات التوقف والبدء في تسلسل الترميز المنبع والمصب ، على التوالي ، ضمن عوامل ثنائية الاتجاه مصممة بشكل رشيد. (ب) تُظهر قياسات الإسفار مستويات التعبير لمراسلي mRFP1 (السفلي) و (أعلى) GFPmut3b بعد تعديل معدلات ترجمة mRFP1 لتكون إما (أشرطة سوداء) منخفضة جدًا أو (بيج) عالية جدًا. (ج) تحليل هذه القياسات يكشف كيف أن معامل إعادة البدء (كإعادة) يعتمد على المسافة بين الجينات وفقًا لنموذج المعلمات الثلاثة (ر 2 = 0.91, ص = 5.94 × 10 −12). القيم وأشرطة الخطأ هي متوسط ​​و SD لاثنين على الأقل من مكررات.

قياس ونمذجة معدلات إعادة بدء الريبوسوم. (أ) تُحسب المسافة بين الجينات وفقًا لمواقف كودونات التوقف والبدء في تسلسل الترميز المنبع والمصب ، على التوالي ، ضمن عوامل ثنائية الاتجاه مصممة بشكل رشيد. (ب) تُظهر قياسات الإسفار مستويات التعبير لمراسلي mRFP1 (السفلي) و (أعلى) GFPmut3b بعد تعديل معدلات ترجمة mRFP1 لتكون إما (أشرطة سوداء) منخفضة جدًا أو (بيج) عالية جدًا. (ج) تحليل هذه القياسات يكشف كيف أن معامل إعادة البدء (كإعادة) يعتمد على المسافة بين الجينات وفقًا لنموذج المعلمات الثلاثة (ر 2 = 0.91, ص = 5.94 × 10 −12). القيم وأشرطة الخطأ هي متوسط ​​و SD لاثنين على الأقل من مكررات.

تم الجمع بين أحد عشر تسلسلًا بين الجينات وتسلسل RBS المنبع لإنشاء 22 مشغلًا ثنائي الموجات. تم رصد مستويات مضان mRFP1 و GFPmut3b خلال فترة طويلة بكتريا قولونية تم الحفاظ على مزارع DH10B في مرحلة النمو الأسي ، وتم تسجيلها باستخدام قياس التدفق الخلوي (قسم "المواد والطرق"). كانت جميع توزيعات الفلورة أحادية الخلية أحادية النمط. يتم سرد جميع التسلسلات والقياسات في البيانات التكميلية. كما هو متوقع ، زاد التعبير عن CDS المنبع (mRFP1) بشكل كبير نتيجة لزيادة معدل الترجمة ، في المتوسط ​​3160 ضعفًا. في نفس الوقت ، زاد أيضًا التعبير عن CDS المتجه نحو المصب (GFPmut3b) بشكل كبير ، من 4 إلى 49 ضعفًا ، وكان حجم الزيادة يعتمد على المسافة بين الجينات (الشكل 2 ب).

نموذج يعتمد على المسافة بين الجينات لمعدل إعادة بدء الريبوسوم

قمنا بتحديد العلاقة بين معدل إعادة بدء الريبوسوم والمسافة بين الجينات من خلال مقارنة الزيادة في تعبير CDS المنبع بالزيادة في تعبير CDS المصب. لكل مسافة جينية ، نحسب القيمة الظاهرية لـ كإعادة بقسمة الفرق في تعبير CDS المتلقين للمعلومات (GFPعالي - GFPقليل مضان) عن طريق الاختلاف في تعبير CDS المنبع (mRFP1عالي - mRFP1قليل مضان) ، والذي ينتج عنه معامل قياس نسب مستقل عن حسابات نموذجنا (الشكل 2 ج). لقد وجدنا أن كإعادة له علاقة خطية بمسافة جينية بين -25 و 25 ، باستثناء مسافة −4. يحتوي النموذج الناتج على ثلاث معلمات مُجهزة ويحسب بدقة معدلات ترجمة CDS المتلقية لـ 22 مشغلًا ثنائي النظام (ر 2 = 0.91, ص = 5.94 × 10 −12) (الشكل التكميلي S1). كانت إعادة بدء الريبوسوم ثابتة إلى حد كبير د بين 0 و 25 نيوكليوتيدات مع كإعادة = 0.0072 ± 0.0018 ، وانخفضت حيث أصبحت المسافة بين الجينات أكثر سلبية من د = 10 بميل ثابت قدره 0.0004 لكل نيوكليوتيد (0.00040 ± 3 × 10 −5). على مسافة جينية من −4 ، كان معدل إعادة البدء أعلى بكثير مع كإعادة = 0.0220 ، بسبب ارتباط الحمض الريبي النووي النقال المحسن. في قسم المناقشة ، نقترح نموذجًا ميكانيكيًا يشرح كيف تعتمد معدلات إعادة بدء الريبوسوم على المسافات بين الجينات من حيث معدلات مسح الريبوسوم وفصله.

قياسات التألق وبالتالي القيم المطلقة كإعادة تعتمد على ثابت تناسب واحد غير معروف ك التي تعكس بروتينات المراسل المختارة ومعلمات قياس التدفق الخلوي المستخدمة لقياس مستويات التألق. لتحديد قيمة ثابت التناسب هذا ، سجلنا مضان mRFP1 و GFPmut3b في أوبرا أحادية cistronic على نفس المتجه ووجدنا كمية أقل بمقدار 10.3 أضعاف من مضان GFPmut3b ، مقارنة بفلورة mRFP1 ، عند التعديل لمعدلات مختلفة من التعبير البروتيني. هذا واضح ك يرتبط ارتباطًا مباشرًا بالثابت كص مضروبة في كإعادة للوصول إلى معدل إعادة بدء الريبوسوم ك مضروبا كص يجب أن يساوي واحد. نتيجة لذلك ، وضعنا كص إلى 10 ومعاملته على أنه ثابت للفترة المتبقية من هذه الدراسة. أدناه ، استخدمنا جميع قياسات المشغل وتحليل الحساسية للعثور على قيمة كص، مما أدى إلى إجابة مماثلة.

توقع معدلات الاقتران متعدية في الاوبرونات ثنائية الموجات

بعد ذلك ، قمنا بدراسة قدرة النموذج البيوفيزيائي على التنبؤ بمعدل الاقتران متعدية من خلال تصميم وتوصيف 76 متغيرًا من الأوبرا ثنائية النظام بستة مناطق جينية مختلفة. تم تصميم المناطق الجينية لتكون لها هياكل mRNA مثبطة تتداخل مع CDS المنبع وتتكشف عن طريق الريبوسومات المطولة في المنبع. ثلاث مناطق لها نفس المسافة بين الجينات (د = −4) مع هياكل mRNA المقترنة متعدية التي لديها طاقات حرة أعلى بشكل متزايد من تتكشف (Δجياقتران = −5.3 و 12.6 و −16.9 كيلو كالوري / مول) (الشكل 3 أ).على وجه الخصوص ، لهيكلان مرنا الأخيران أشكال متطابقة ، ولكن مع تركيبات نيوكليوتيد مختلفة وثبات مزدوج. المناطق الثلاث الأخرى لها مسافات متفاوتة بين الجينات (د = +3 ، −1 ، −11) مع تداخل متشابك مستقر ، هياكل mRNA المثبطة (Δجياقتران = -8.9 أو 11.1 كيلو كالوري / مول) (الشكل 3 ب). بالنسبة لجميع المناطق الجينية ، قمنا بعد ذلك بتصميم 12-13 تسلسلًا اصطناعيًا لـ RBS لزيادة معدل ترجمة CDS المنبع بشكل منهجي من 1 إلى 391000 على المقياس التناسبي لـ RBS Calculator. تعتمد معدلات ترجمة CDS المصب أيضًا على معدلات الترجمة الأساسية (غير المقترنة) ، التي تحدد Δجيأخير و Δجيغير اقتران الطاقات الحرة. يتم سرد جميع التسلسلات والقياسات والحسابات في البيانات التكميلية.

توقع اقتران متعدية في المشغلات ثنائية الموجات. تم تصميم المناطق بين الجينات لأوبرونات المراسل ثنائية الموجات وتمييزها لتحديد كيفية التحكم الكمي في هياكل الحمض النووي الريبي المثبطة في الاقتران الترجمي. (الخطوط السوداء) باستخدام تنبؤات النماذج الفيزيائية الحيوية ج = 0.81 و كص = 10 تظهر جنبًا إلى جنب (الدوائر السوداء) قياسات مستوى التعبير mRFP1 و GFPmut3b المنبع مثل mRFP1 يتم زيادة معدلات الترجمة بشكل منهجي. ألوان النوكليوتيدات هي نفسها كما في الشكل 1. (أ) محسوبة Δجياقترانجيغير اقتران) الطاقات الحرة −5.3 (20.1) ، 12.6 (16.3) و 16.9 (16.3) kcal / mol ، على التوالي. تسلط المربعات الضوء على أربعة طفرات نيوكليوتيدية بين متغيرين من الأوبرا. (ب) تم تصميم ثلاثة أوبراون ثنائية إلكترونية إضافية بمسافات متفاوتة بين الجينات (د = +3 و 1 و 11 على التوالي) وهياكل الحمض النووي الريبي المثبطة. محسوب Δجياقترانجيغير اقتران) الطاقات الحرة −8.9 (−12.6) ، −8.9 (−9.8) و −11.1 (17.7) kcal / mol ، على التوالي. (ج) تتم مقارنة معدلات بدء الترجمة المتوقعة بمستويات التعبير CDS (GFPmut3b) المقاسة. عوامل التناسب الظاهرة هي (المربعات الزرقاء ، pTTBd-4-13) 9.8 ، (الدوائر الحمراء ، pTTBd-4-17) 5.5 ، (الماس الأخضر ، pTTBd-4-5) 17.3 ، (الدوائر السوداء ، pTTBd3-9) 31.0 ، (مثلثات وردية ، pTTBd-1-9) 30.8 و (نجوم بنية ، pTTBd-11-11) 4.3 مع معاملات بيرسون ر 2 من 0.85 (ص = 5 × 10 −5 ), 0.86 (ص = 8 × 10 −6 ), 0.84 (ص = 3 × 10 −5 ), 0.77 (ص = 2 × 10 −4 ), 0.74 (ص = 4 × 10 −4) و 0.60 (ص = 0.0069) ، على التوالي. القيم وأشرطة الخطأ هي متوسط ​​وثلاثة مكررات. (د) مستويات mRNA من mRFP1 و gfpmut3b تم قياس تسلسل الترميز ضمن أربعة متغيرات من المشغل الثنائي pTTBd-4-17 باعتباره mRFP1 تمت زيادة معدلات الترجمة من 1 إلى 200000 au على المقياس التناسبي لـ RBS Calculator ، مما يُظهر تأثيرات الترجمة الأولية على استقرار mRNA في المشغل. القيم وأشرطة الخطأ هي متوسط ​​و SD لاثنين على الأقل من مكررات.

توقع اقتران متعدية في المشغلات ثنائية الموجات. تم تصميم المناطق بين الجينات لأوبرونات المراسل ثنائية الموجات وتمييزها لتحديد كيفية التحكم الكمي في هياكل الحمض النووي الريبي المثبطة في الاقتران الترجمي. (الخطوط السوداء) باستخدام تنبؤات النماذج الفيزيائية الحيوية ج = 0.81 و كص = 10 تظهر جنبًا إلى جنب (الدوائر السوداء) قياسات مستوى التعبير mRFP1 و GFPmut3b المنبع مثل mRFP1 يتم زيادة معدلات الترجمة بشكل منهجي. ألوان النوكليوتيدات هي نفسها كما في الشكل 1. (أ) محسوبة Δجياقترانجيغير اقتران) الطاقات الحرة −5.3 (20.1) ، 12.6 (16.3) و 16.9 (16.3) kcal / mol ، على التوالي. تسلط المربعات الضوء على أربعة طفرات نيوكليوتيدية بين متغيرين من الأوبرا. (ب) تم تصميم ثلاثة أوبراون ثنائية إلكترونية إضافية بمسافات متفاوتة بين الجينات (د = +3 و 1 و 11 على التوالي) وهياكل الحمض النووي الريبي المثبطة. محسوب Δجياقترانجيغير اقتران) الطاقات الحرة هي 8.9 (−12.6) و 8.9 (9.8) و 11.1 (17.7) kcal / mol على التوالي. (ج) تتم مقارنة معدلات بدء الترجمة المتوقعة بمستويات التعبير CDS (GFPmut3b) المقاسة. عوامل التناسب الظاهرة هي (المربعات الزرقاء ، pTTBd-4-13) 9.8 ، (الدوائر الحمراء ، pTTBd-4-17) 5.5 ، (الماس الأخضر ، pTTBd-4-5) 17.3 ، (الدوائر السوداء ، pTTBd3-9) 31.0 ، (مثلثات وردية ، pTTBd-1-9) 30.8 و (نجوم بنية ، pTTBd-11-11) 4.3 مع معاملات بيرسون ر 2 من 0.85 (ص = 5 × 10 −5 ), 0.86 (ص = 8 × 10 −6 ), 0.84 (ص = 3 × 10 −5 ), 0.77 (ص = 2 × 10 −4 ), 0.74 (ص = 4 × 10 −4) و 0.60 (ص = 0.0069) ، على التوالي. القيم وأشرطة الخطأ هي متوسط ​​وثلاثة مكررات. (د) مستويات mRNA من mRFP1 و gfpmut3b تم قياس تسلسل الترميز ضمن أربعة متغيرات من المشغل الثنائي pTTBd-4-17 باعتباره mRFP1 تمت زيادة معدلات الترجمة من 1 إلى 200000 au على المقياس التناسبي لـ RBS Calculator ، مما يُظهر تأثيرات الترجمة الأولية على استقرار mRNA في المشغل. القيم وأشرطة الخطأ هي متوسط ​​و SD لاثنين على الأقل من مكررات.

راقبنا مستويات تعبير CDS المنبع (مضان mRFP1) والمصب (مضان GFPmut3b) لـ 76 عاملًا ثنائي cistronic خلال الثقافات الطويلة التي تم الحفاظ عليها في مرحلة النمو الأسي ، وسجلنا توزيعات مضان أحادية الخلية باستخدام قياس التدفق الخلوي (أساليب). تسببت RBSs المنبع التي تتحكم في ترجمة CDS المنبع في زيادة مضان mRFP1 بمقدار 21000 إلى 44000 ضعف مع معدلات بدء الترجمة المتوقعة جيدًا (ر 2 = 0.57) (الشكل التكميلي S2) ، بمتوسط ​​ستة مناطق بين الجينات. الاستثناءات هي 391000 au RBS ، والتي أسفرت عن تألق mRFP1 مثل 94000 au RBS ، ربما بسبب إدخال خطوة أخرى لتحديد المعدل في التعبير الجيني ، مثل استطالة الترجمة. من أدنى مستويات تعبير CDS إلى أعلى المنبع ، زاد تعبير CDS المصب بمقدار 57- و 126- و 95 ضعفًا ، على التوالي ، للمناطق الثلاثة الأولى بين الجينات (الشكل 3 أ) و 54- و 125- و 55 ضعفًا ، على التوالي ، للمناطق الثلاث الثانية بين الجينات (الشكل 3 ب). تمشيا مع النموذج الفيزيائي الحيوي المقترح ، كانت هناك علاقة سينية بين مستويات التعبير CDS المنبع والمصب.

كان من المتوقع أن التغييرات في مستوى mRNA قد تلعب دورًا في التغييرات الملحوظة في تعبير CDS في اتجاه مجرى النهر حيث تصبح تسلسلات التشفير المترجمة بشكل سيئ متاحة لنشاط ربط RNAse وانقسام. على وجه الخصوص في معدلات ترجمة CDS المنخفضة المنبع ، فإن زعزعة استقرار mRNA بأكمله سيؤثر على كل من تعبير CDS المنبع والمصب. للتحقيق في هذا الاحتمال ، قمنا بقياس مستويات الرنا المرسال لأوبرون ثنائي النواة حيث تمت زيادة ترجمة CDS المنبع من معدل منخفض جدًا إلى معدل مرتفع جدًا. اخترنا متغير مشغل (pTTBd-4-17 ، الشكل 3A ، يمين) واستخدمنا qRT-PCR للقياس mRFP1 و gfpmut3b مستويات الرنا المرسال مقارنة بمستويات الرنا الريباسي 16S الذاتية (قسم "المواد والطرق"). لقد وجدنا أن مستويات mRNA لـ CDS المنبع انخفضت بنحو 2 ضعف حيث انخفض معدل الترجمة بشكل كبير (الشكل 3D). نظرًا لتأثيرات معالجة mRNA ، انخفض مستوى CDS mRNA أيضًا بنحو 1.7 ضعف عندما كان معدل ترجمة CDS المنبع منخفضًا. لذلك ، في حين أن التغييرات في استقرار mRNA تعد عاملاً ، فإنها لا تستطيع تفسير تغيير & gt50 ضعفًا في تعبير CDS في اتجاه المصب نظرًا لتنوع معدلات ترجمة CDS المنبثقة بشكل منهجي.

ثم أجرينا مقارنات كمية بين هذه القياسات والحسابات الفيزيائية الحيوية لتحديد ما إذا كان نموذج واحد يمكن أن يشرح كيف أن تغيير معدل ترجمة CDS المنبع يتحكم في معدلات ترجمة CDS النهائية. أولاً ، استخدمنا هذه القياسات لتحديد قيمة معامل الكشف بمساعدة الريبوسوم ، ج، والذي يربط معدل استطالة الريبوسومات المنبع بالجزء من الوقت الذي تم فيه الكشف عن بنية الحمض النووي الريبي بواسطة الريبوسوم. المعلمة ج يتحكم في انحدار المنحنى السيني الذي يربط معدلات ترجمة CDS عند المنبع والمصب عبر آلية بدء de novo. قررنا ذلك ج هو 0.81 ± 0.17 عن طريق تطبيع قياسات مضان 76 GFPmut3b ، وطرح معدلات إعادة البدء كمصدر للاقتران متعدية ، وإيجاد أفضل قيمة ملائمة لـ ج التي قللت من الفرق بين القياسات المقيسة ومعدلات بدء ترجمة CDS المتنبأ بها. أدى تركيب هذه المعلمة الفردية إلى تنبؤات دقيقة لمعدل بدء الترجمة لمقاييس CDS النهائية عبر 76 قياسًا بمتوسط ​​Pearson ر 2 من 0.78 (الشكل 3 ج). في المقابل ، إذا لم يتم تضمين آلية الاقتران متعدية في النموذج الفيزيائي الحيوي ، فإن تنبؤات النموذج لم تكن قابلة للمقارنة بمعدلات الترجمة المقاسة (متوسط ر 2 = 0.01) (الشكل التكميلي S3).

لاحظنا أن تغيير المنطقة بين الجينات يمكن أن يكون له تأثير نسبي على المقدار المطلق لتعبير CDS المتجه إلى ما وراء الآلية المرصودة للاقتران متعدية. باستخدام النموذج الفيزيائي الحيوي للتمييز بين التفاعلات المعروفة وغير المعروفة ، وجدنا أن اثنتين من المناطق الجينية الست لديها مستويات تعبير Gfpmut3b متوقعة بشكل مفرط مع أقصى تغيير نسبي يبلغ 7.2 ضعفًا عبر جميع معدلات ترجمة CDS المنبع.

التنبؤ بمعدلات الاقتران متعدية في الاوبرونات الثلاثية

قمنا كذلك بتقييم تنبؤات النموذج البيوفيزيائي من خلال تصميم وبناء وتوصيف 44 متغيرًا ثلاثي الأوبون يستخدم مراسلي CFP و mRFP1 و GFPmut3b. تم إنشاء أربع مجموعات مختلفة من المناطق الجينية حيث احتوت المنطقة الجينية الأولى بين CFP و mRFP1 على بنيتين مختلفتين من الحمض النووي الريبي المثبط مع Δجياقتران طاقات −14.5 و −9.1 kcal / mol ، بينما احتوت المنطقة الجينية الثانية بين mRFP1 و GFPmut3b على هياكل RNA مثبطة مع Δجياقتران طاقات −12.6 و −5.3 كيلو كالوري / مول. لزيادة التعبير بشكل منهجي عن معظم CDS المنبع ، قمنا بتصميم وإدخال 11 موقع ربط ريبوسوم اصطناعي يتحكم في تعبير CFP بمعدلات بدء الترجمة من 10 إلى 268000 على المقياس النسبي RBS Calculator. قمنا بعد ذلك بمراقبة مستويات التعبير CFP و mRFP1 و GFPmut3b لمتغيرات الأوبون الـ 44 خلال الثقافات الطويلة التي تم الحفاظ عليها في مرحلة النمو الأسي ، وسجلنا توزيعات مضان أحادية الخلية باستخدام قياس التدفق الخلوي (قسم "المواد والطرق").

مع زيادة معدلات ترجمة CDS المنبع ، أدى الاقتران متعدية بين CFP و mRFP1 إلى زيادة تعبير mRFP1 بين 10.5 إلى 31.3 ضعفًا (الشكل 4). في الوقت نفسه ، أدى الاقتران متعدية الأطراف بين mRFP1 و GFPmut3b إلى زيادة تعبير GFPmut3b بين 41.8 و 83.3 ضعفًا. تم توقع العلاقات بين معدلات ترجمة CDS المنبع والمصب بشكل جيد من خلال حسابات النموذج الفيزيائي الحيوي (الشكل 4).

قياسات التعبير عن الأوبرا الثلاثية. تم تصميم المناطق بين الجينات لأربعة أوبراون ثلاثية السلك بشكل عقلاني وتمييزها لتقييم تنبؤات النموذج الفيزيائي الحيوي. (الخطوط الزرقاء) باستخدام تنبؤات النماذج الفيزيائية الحيوية ج = 0.81 و كص = 10 بجانب قياسات مستوى التعبير (الدوائر السوداء) لمراسلي CFP و mRFP1 و GFPmut3b باعتبارها CFP يتم زيادة معدلات الترجمة بشكل منهجي. محسوب Δجياقترانجيغير اقتران) الطاقات الحرة للمنطقتين الجينيتين هي (أ) −14.5 (−15.4) و 12.6 (16.3) (ب) −9.1 (−16.5) و 5.3 (20.1) (ج) −14.5 (15.4) و 5.3 (20.1) (د) −9.1 (−16.5) و 12.6 (16.3) كيلو كالوري / مول. جميعها لها مسافات بين الجينات د = −4. القيم وأشرطة الخطأ هي متوسط ​​و SD لاثنين على الأقل من مكررات.

قياسات التعبير للأوبرونات ثلاثية السيسترونيك. تم تصميم المناطق بين الجينات لأربعة أوبراون ثلاثية السلك بشكل عقلاني وتمييزها لتقييم تنبؤات النموذج الفيزيائي الحيوي. (الخطوط الزرقاء) باستخدام تنبؤات النماذج الفيزيائية الحيوية ج = 0.81 و كص = 10 بجانب قياسات مستوى التعبير (الدوائر السوداء) لمراسلي CFP و mRFP1 و GFPmut3b باعتبارها CFP يتم زيادة معدلات الترجمة بشكل منهجي. محسوب Δجياقترانجيغير اقتران) الطاقات الحرة للمنطقتين الجينيتين هي (أ) 14.5 (15.4) و 12.6 (16.3) (ب) −9.1 (−16.5) و 5.3 (20.1) (ج) −14.5 (15.4) و 5.3 (20.1) (د) −9.1 (−16.5) و 12.6 (16.3) كيلو كالوري / مول. كلها لها مسافات بين الجينات د = −4. القيم وأشرطة الخطأ هي متوسط ​​و SD لاثنين على الأقل من مكررات.

على وجه التحديد ، زادت مستويات تعبير CFP بشكل متناسب مع معدل بدء الترجمة لتسلسلات RBS المصممة (متوسط ر 2 = 0.67) (الشكل 5 أ د) ، باستثناء معدل ترجمة قدره 268000 وحدة دولية حيث وصل التعبير إلى هضبة. للتنبؤ ب mRFP1 معدلات الترجمة المتوقعة CFP أسعار الترجمة و cfp-mRFP1 تم بعد ذلك إدخال التسلسل الجيني في النموذج الفيزيائي الحيوي للاقتران الانتقالي (المعادلات (1-5)) باستخدام قيم المعلمات المحددة مسبقًا (ج = 0.81, كص = 10). مقارنة بمستويات التعبير المقاسة ، تنبأ النموذج الفيزيائي الحيوي بدقة mRFP1 أسعار الترجمة على مقياس نسبي (متوسط ر 2 = 0.82) (الشكل 5 ب هـ) ، خاصة بالنسبة للمناطق الجينية التي أسفرت عن مستويات تعبير أعلى (الشكل 4 أ ج د) ، حيث بيرسون ر كانت مقارنات 2 0.94 (ص = 3 × 10 −6 ), 0.91 (ص = 2 × 10 −5) و 0.90 (ص = 3 × 10 −5). ال gfpmut3b تم التنبؤ بمعدلات بدء الترجمة باستخدام نفس النهج المتوقع mRFP1 أسعار الترجمة و mRFP1-gfpmut3b تم إدخال التسلسل الجيني في النموذج الفيزيائي الحيوي ومعدلات بدء الترجمة gfpmut3b تم حسابها. مقارنة بمستويات التعبير المقاسة ، كان النموذج الفيزيائي الحيوي قادرًا أيضًا على التنبؤ بدقة gfpmut3b أسعار الترجمة على مقياس نسبي (متوسط ر 2 = 0.73) (الشكل 5C F). كما كان من قبل ، أدى استبعاد آلية الاقتران متعدية من النموذج الفيزيائي الحيوي إلى انخفاض حاد في الدقة mRFP1 و gfpmut3b لم تكن معدلات الترجمة متوقعة جيدًا (ر قيمتان & lt 0.01) (الشكل التكميلي S4). بشكل عام ، كان دمج الاقتران الترجمي في النموذج الفيزيائي الحيوي ضروريًا للتنبؤ بدقة بمعدلات بدء الترجمة داخل المشغلات متعددة الكواكب.

تنبؤات النموذج البيوفيزيائي للأوبرونات الثلاثية. (أ) مقارنة بين قياسات التعبير عن المشغلات ثلاثية الموجات وتنبؤات النموذج البيوفيزيائي للاقتران متعدية دون استخدام عامل التناسب. (ب) يتم إجراء نفس المقارنة بعد ضرب معدلات الترجمة المتوقعة في عوامل التناسب كما هو موضح. متوسط ​​بيرسون ر قيمتان للمقارنة هي 0.67 و 0.82 و 0.73 ، من اليسار إلى اليمين على التوالي ، ولم تتغير بقيمة عامل التناسب. تمثل الألوان متغيرات الأوبرا (أسود) pTTD-4-15-13 ، (أحمر) pTTTd-4-9-5 ، (أخضر) pTTTd-4-15-5 و (أزرق) pTTTd-4-9-13. القيم وأشرطة الخطأ هي متوسط ​​و SD لاثنين على الأقل من مكررات.

تنبؤات النموذج البيوفيزيائي للأوبرونات الثلاثية. (أ) مقارنة بين قياسات التعبير عن المشغلات ثلاثية الموجات وتنبؤات النموذج الفيزيائي الحيوي للاقتران متعدية دون استخدام عامل التناسب. (ب) يتم إجراء نفس المقارنة بعد ضرب معدلات الترجمة المتوقعة في عوامل التناسب كما هو موضح. متوسط ​​بيرسون ر قيمتان للمقارنة هي 0.67 و 0.82 و 0.73 ، من اليسار إلى اليمين على التوالي ، ولم تتغير بقيمة عامل التناسب. تمثل الألوان متغيرات الأوبرا (أسود) pTTD-4-15-13 ، (أحمر) pTTTd-4-9-5 ، (أخضر) pTTTd-4-15-5 و (أزرق) pTTTd-4-9-13. القيم وأشرطة الخطأ هي متوسط ​​و SD لاثنين على الأقل من مكررات.

الأهم من ذلك ، على الرغم من أن الأوبرا ثنائية cistronic و tri-cistronic لها متواليات مختلفة بوضوح 5 UTR ومتواليات جينية بالإضافة إلى أوامر الجينات ، كان النموذج قادرًا على التنبؤ بمعدلات بدء الترجمة بدقة مماثلة. على سبيل المثال ، إضافة امتداد CFP غيّر تسلسل تشفير البروتين كأول جين داخل الأوبون الثلاثي بدء الترجمة لـ 5 UTR من خلال تمكين تكوين هياكل mRNA التي تمنع ارتباط الريبوسوم. ثم تم نشر هذه التغييرات في معدل ترجمة CDS المنبع للأمام عبر اقتران متعدية للتأثير على معدلات الترجمة لكل من mRFP1 و gfpmut3b أقراص CDS. من خلال تحديد نقاط القوة للتفاعلات الجزيئية التي تتحكم في بدء الترجمة والاقتران متعدية ، كان النموذج قادرًا على حساب هذه التغييرات المهمة في تسلسل التشغيل والهندسة المعمارية.

ثم أجرينا تحليل الحساسية على عامل التحويل بين تجميع الريبوسوم ومعدل إعادة البدء (كص) وثابت تتكشف بمساعدة الريبوسوم (ج) لتحديد كيف أدى تغيير قيمها إلى تغيير تنبؤات معدل بدء الترجمة للنموذج. قمنا بتحديد نطاق قيم المعلمات التي أسفرت عن تنبؤات معدل الترجمة ضمن فاصل الثقة 95٪ ، باستخدام متغيرات التشغيل 120 ثنائية وثلاثي cistronic ، بإجمالي 360 مستوى تعبير مقترن متعدِّدًا ، كقياسات تجريبية. وجدنا أن أفضل القيم المناسبة لـ كص و C كانت 14 و 0.81 ، على التوالي ، وأن نطاقات الثقة 95 ٪ لهذه المعلمات كانت [8،33] و [0.67،1] (الشكل التكميلي S5). تغيير قيمة ج، استنادًا إلى قياسات الأوبرا ثنائية cistronic ، لم تحسن من قدرة النموذج على التنبؤ بمعدلات بدء الترجمة في الأوبرا ثري-سيسترونيك. وبالمثل ، فإن أفضل قيمة تناسب كص يتفق إلى حد كبير مع القياس السابق لـ كص التي اعتمدت على قياسات منفصلة للتعبير أحادي cistronic mRFP1 و GFPmut3b.

ومع ذلك ، وجدنا أن التعديلات التي تم إجراؤها على المناطق الجينية كان لها تأثير على مستويات التعبير المطلق لأقراص CDS في المصب داخل أوبراز ثلاثي السيسترونيك (الشكل 5).على سبيل المثال ، بعد احتساب الاختلافات المتوقعة في معدلات الترجمة ، كان هناك انخفاض بمقدار 8 أضعاف في تعبير mRFP1 في جميع معدلات ترجمة cfp المنبع (الشكل 5 ب) عندما يكون منعطف حاد في الحمض النووي الريبي cfp-mRFP1 كان للمنطقة الجينية جذع قصير (الشكل 4 أ مقابل الشكل 4 د). أدى هذا التعديل في المنطقة الجينية cfp-mRFP1 أيضًا إلى خفض تعبير GFPmut3b في جميع المراحل الأولية CFP معدلات الترجمة بمقدار 4.5 أضعاف ، على الرغم من أن المنطقة الجينية mRFP1-gfpmut3b لم تتغير. التخفيضات في تعبير mRFP1 و GFPmut3b ، بشكل مستقل عن CFP معدل الترجمة ، يشير إلى وجود تفاعلات أخرى لها تأثير مضاعف على تعبير البروتين (مثل التغييرات في استقرار mRNA). يتم تحديد حجم هذه التفاعلات كمياً بواسطة عامل تناسب ظاهر ك.

في المقابل ، إذا كان mRFP1-gfpmut3b تم تعديل المنطقة الجينية أثناء مغادرة cfp-mRFP1 المنطقة بين الجينات دون تغيير ، انخفضت مستويات التعبير GFPmut3b فقط بعامل 2.3 على الإطلاق CFP معدلات الترجمة ، بينما كانت مستويات التعبير mRFP1 متشابهة إلى حد كبير (تغيير 1.45 مرة) (الشكل 4 أ مقابل الشكل 4 ج). لذلك ، كانت العوامل الإضافية التي تتحكم في التغييرات النسبية في مستوى التعبير ، بخلاف الاقتران متعدية ، خاصة بالتسلسل ولا توجد هنا إلا داخل المنطقة الجينية الأولى. بشكل عام ، عبر المناطق الجينية الأربعة ، المستويات المطلقة لـ mRFP1 و gfpmut3b اختلفت مستويات التعبير عن تنبؤات النموذج بعامل نسبي يبلغ 13.85 و 10.2 ضعفًا على الأكثر (الشكل 5 د هـ و). تحدد هذه الاختلافات في عامل التناسب حجم التفاعلات ، بما يتجاوز الاقتران متعدية ، التي يمكن أن تؤثر على مستويات التعبير CDS في اتجاه المصب ، ولكنها غير مدرجة في النموذج. أدناه ، نناقش كيف يمكن لدمج آليات تنظيم الجينات الإضافية في المشغلات أن يفسر التغييرات في عامل التناسب الظاهري.

توقع اقتران متعدية في مشغل طبيعي

لقد مكّن التقدم في المقايسات القائمة على التسلسل من الجيل التالي القياسات الكمية لمستويات الرنا المرسال وشغل الريبوسوم عبر نسخة الكائن الحي (37 ، 45). على وجه الخصوص ، تم تطبيق تقنيات التنميط RNA-Seq والريبوسوم مؤخرًا على بكتريا قولونية MG1655 لتحديد مستويات mRNA على مستوى الجينوم وإشغال الريبوسوم في وسائط MOPS الكاملة ، والحد الأدنى ، والخالية من الميثيونين (38). هنا ، نطبق نموذجنا الفيزيائي الحيوي لبدء الترجمة والاقتران الانتقالي للتنبؤ بمعدلات بدء الترجمة لتسلسلات الترميز داخل مشغل طبيعي ومقارنتها بالقياسات على مستوى الجينوم.

قبل هذه المقارنات ، من المهم فحص أنواع البيانات الناتجة عن هذه التقنيات القائمة على التسلسل وتحليل الافتراضات اللازمة لمقارنة هذه القياسات بنموذج التنبؤات. أولاً ، عادةً ما يتم الإبلاغ عن قياسات RNA-Seq باستخدام وحدات القراءات لكل كيلو قاعدة من mRNA لكل مليون قراءة (RPKM). تمثل وحدة RPKM الاختلافات في طول CDS وتغطية التسلسل ، وتوفر قياسًا نسبيًا لتركيز الرنا المرسال ، على الرغم من أن متوسط ​​RPKM عبر النسخ سيختلف من كائن حي إلى آخر (46). لذلك ، توجد قياسات مستوى mRNA بوحدات RPKM على مقياس نسبي.

وبالمثل ، فإن تقنية التنميط الريبوسوم تسجل عدد الريبوسومات المرتبطة بنسخ الرنا المرسال ، والتي يتم حساب متوسطها عبر طول CDS لتوفير أرقام الريبوسوم على مستوى الجينات. يمكن قياس متوسط ​​عدد الريبوسومات لكل نسخة من الرنا المرسال عن طريق قسمة أرقام الريبوسوم على مستوى الجينات عن طريق قياسات مستوى الرنا المرسال ، مما ينتج عنه مقياس كمي لكثافة الريبوسوم على مستوى الجين. ومع ذلك ، فإن التحويل من كثافات الريبوسوم إلى معدلات ترجمة mRNA يعتمد على كل من بدء ترجمة mRNA ومعدلات الاستطالة ، مما يربك المقارنة المباشرة بين كثافات الريبوسوم المقاسة ومعدلات بدء الترجمة المتوقعة من النموذج. بدلاً من ذلك ، في التحليل الأولي لقياسات التنميط الريبوسوم (38) ، كان من المفترض أن كل شيء بكتريا قولونية الجينات لها نفس معدلات استطالة الترجمة ، على الرغم من أن هذا الافتراض لم يتم التحقق من صحته تجريبياً وليس من المحتمل أن يكون صحيحًا. على وجه الخصوص ، قياس كثافة الريبوسوم 90٪ من بكتريا قولونية اختلفت الجينات بنسبة 11.8 ضعفًا فقط. إذا كانت معدلات استطالة الترجمة هي نفسها بالنسبة لجميع الجينات ، فإن ذلك يعني أن معدلات بدء الترجمة لا تختلف إلا بمقدار 11.8 ضعفًا عبر كامل النص ، وهو أيضًا ليس من المرجح أن يكون صحيحًا. لذلك ، يجب علينا فقط مقارنة كثافات الريبوسوم المقاسة بمعدلات بدء الترجمة المتوقعة عندما يكون هناك سبب للشك في أن تسلسلات التشفير داخل المشغل لها معدلات استطالة ترجمة متساوية تقريبًا.

اخترنا atpIBEFHAGDC Operon كما تم استخدامه سابقًا كمثال توضيحي (38) ولأنه يشفر تسعة متواليات تشفير بدون أي محفزات داخلية معروفة أو نهايات نسخ. ترتبط بروتينات ATP معًا لتشكيل معقد متعدد القوالب كبير الحجم ، يتكون من مركب ATP synthase F0 (AtpBE10F2) ومركب ATP synthase F1 (AtpHA3جي دي3C) ، وبالتالي من المرجح أن يكون لديهم معدلات استطالة ترجمة متزامنة ومتشابهة. وفقًا لذلك ، كانت الأعداد المقاسة من الريبوسومات المرتبطة بكل CDS متناسبة تقريبًا مع المقاييس المتكافئة للبروتين المتوقع داخل مجمع سينسيز ATP. على سبيل المثال ، عدد الريبوسومات المرتبطة بنسخة ATPE كان 10.7 ضعف من atpB نتيجة لمستوى مرنا أعلى بمقدار 2.4 ضعفًا ونسبة إشغال ريبوسوم أعلى بمقدار 4.4 ضعفًا لكل نسخة. على وجه الخصوص ، لأن ATP يتميز Operon بتسعة جينات وأربعة مقاييس متكافئة مختلفة للبروتين ، ويوفر عددًا أكبر من نقاط البيانات الفريدة للمقارنة مقارنة بالمشغلات الأخرى.

عند استخدام موقع بدء النسخ المقاسة تجريبياً في المنبع ATPI وكودون GUG الأكثر ترجمة يبدأ لـ ATPI، كان النموذج الفيزيائي الحيوي قادرًا على التنبؤ بدقة بمعدلات بدء الترجمة ومعدلات اقتران الترجمة للجميع ATP الجينات عند مقارنتها بكثافة الريبوسوم المقاسة (ر 2 = 0.72, ص = 0.004) (الجدول 1). عندما لم يتم تضمين اقتران الترجمة في النموذج ، فإن معدلات بدء الترجمة لـ atpF و ATPA كانت أقل دقة في التنبؤ (ر 2 = 0.65, ص = 0.008) إعادة بدء الريبوسوم مسؤولة عن 98٪ من atpF بدء الترجمة ، والمنطقة الجينية لـ ATPA يحتوي على بنية RNA مثبطة متداخلة (Δجياقتران = −5.9 كيلو كالوري / مول) مما يزيد من معدل بدء الترجمة بمقدار 6.5 أضعاف. بشكل عام ، يمكن أن يوضح النموذج الفيزيائي الحيوي لبدء الترجمة والاقتران متعدية لماذا معدلات تخليق البروتين من atpIBEFHAGDC الأوبون متناسب مع مقاييس العناصر الكيميائية المتوقعة للبروتين.

اقتران متعدية في ATP أوبرون

الجين. عدد قراءة الريبوسوم (au). قراءة مرنا (RPKM). الريبوسومات لكل نسخة (au). ترجمة. فيه. معدل (مع اقتران). ترجمة. فيه. معدل (بدون اقتران). عامل المزاوجة .
ATPI 151 764 0.20 0.014 0.014 1.00
atpB 10508 1695 6.20 2.47 2.47 1.00
ATPE 112959 4114 27.46 27.73 27.56 1.01
atpF 17866 3109 5.75 1.98 0.034 57.63
atpH 9335 2938 3.18 2.75 2.15 1.28
ATPA 30696 2724 11.27 4.61 0.71 6.54
atpG 9832 1914 5.14 4.88 4.55 1.07
ATPD 30603 2177 14.06 4.80 4.46 1.08
atpC 12695 2193 5.79 12.60 12.26 1.03
الجين. عدد قراءة الريبوسوم (au). قراءة مرنا (RPKM). الريبوسومات لكل نسخة (au). ترجمة. فيه. معدل (مع اقتران). ترجمة. فيه. معدل (بدون اقتران). عامل المزاوجة .
ATPI 151 764 0.20 0.014 0.014 1.00
atpB 10508 1695 6.20 2.47 2.47 1.00
ATPE 112959 4114 27.46 27.73 27.56 1.01
atpF 17866 3109 5.75 1.98 0.034 57.63
atpH 9335 2938 3.18 2.75 2.15 1.28
ATPA 30696 2724 11.27 4.61 0.71 6.54
atpG 9832 1914 5.14 4.88 4.55 1.07
ATPD 30603 2177 14.06 4.80 4.46 1.08
atpC 12695 2193 5.79 12.60 12.26 1.03

تتم مقارنة معدلات بدء الترجمة المتوقعة للنموذج الفيزيائي الحيوي مع أو بدون اقتران بقياسات كثافة الريبوسوم على مستوى الجين ، والتي تم الحصول عليها مسبقًا بواسطة Li وآخرون. ( 38).

الجين. عدد قراءة الريبوسوم (au). قراءة مرنا (RPKM). الريبوسومات لكل نسخة (au). ترجمة. فيه. معدل (مع اقتران). ترجمة. فيه. معدل (بدون اقتران). عامل المزاوجة .
ATPI 151 764 0.20 0.014 0.014 1.00
atpB 10508 1695 6.20 2.47 2.47 1.00
ATPE 112959 4114 27.46 27.73 27.56 1.01
atpF 17866 3109 5.75 1.98 0.034 57.63
atpH 9335 2938 3.18 2.75 2.15 1.28
ATPA 30696 2724 11.27 4.61 0.71 6.54
atpG 9832 1914 5.14 4.88 4.55 1.07
ATPD 30603 2177 14.06 4.80 4.46 1.08
atpC 12695 2193 5.79 12.60 12.26 1.03
الجين. عدد قراءة الريبوسوم (au). قراءة مرنا (RPKM). الريبوسومات لكل نسخة (au). ترجمة. فيه. معدل (مع اقتران). ترجمة. فيه. معدل (بدون اقتران). عامل المزاوجة .
ATPI 151 764 0.20 0.014 0.014 1.00
atpB 10508 1695 6.20 2.47 2.47 1.00
ATPE 112959 4114 27.46 27.73 27.56 1.01
atpF 17866 3109 5.75 1.98 0.034 57.63
atpH 9335 2938 3.18 2.75 2.15 1.28
ATPA 30696 2724 11.27 4.61 0.71 6.54
atpG 9832 1914 5.14 4.88 4.55 1.07
ATPD 30603 2177 14.06 4.80 4.46 1.08
atpC 12695 2193 5.79 12.60 12.26 1.03

تتم مقارنة معدلات بدء الترجمة المتوقعة للنموذج الفيزيائي الحيوي مع وبدون اقتران بقياسات كثافة الريبوسوم على مستوى الجين ، والتي تم الحصول عليها مسبقًا بواسطة Li وآخرون. ( 38).

معايير التصميم للمناطق بين الجينات لتنسيق التعبير في العوامل التركيبية

باستخدام النموذج الفيزيائي الحيوي ، نقوم الآن بتحليل كيفية تصميم المناطق بين الجينات لتنسيق التعبير البروتيني داخل أوبرا بكتيرية اصطناعية. تشمل تطبيقاتنا المهمة التعبير المشترك عن البروتينات متعددة الوحدات الفرعية والمسارات متعددة الإنزيمات. أولاً ، ستكون معدلات ترجمة CDS في المنبع والمصب في الأوبرا مرتبطة خطيًا عندما لا تحتوي المنطقة الجينية على أي هياكل RNA مثبطة تتداخل مع بصمة الريبوسومات المطولة في المنبع (Δجياقتران = 0). بسبب إعادة بدء الريبوسوم ، يتم التحكم في ميل هذه العلاقة من خلال المسافة بين الجينات بين هذه CDS ويتراوح بين صفر و 0.022. يمكن أن يكون للمنحدر الصغير نسبيًا تأثير كبير على نسب مستوى التعبير عن البروتين عندما يكون لأقراص CDS في المنبع والمصب معدلات ترجمة قاعدية مختلفة على نطاق واسع كما تم تحديدها من خلال تفاعلات الريبوسوم مع الرنا المرسال (Δجيأخير - Δجيغير اقتران). على سبيل المثال ، عندما يحتوي CDS المنبع على معدل ترجمة أساسي أعلى بمقدار 100 ضعف من CDS المتجه نحو المصب (المسافة بين الجينات د = −4) ، لن يكون هناك سوى فرق بمقدار 31 ضعفًا في معدل الترجمة عند أخذ إعادة بدء الريبوسوم في الاعتبار. لمنع مثل هذه الآثار ، يجب تصميم المناطق بين الجينات بحيث تتداخل تسلسلات التشفير مع 25 أو أكثر من النيوكليوتيدات.

ثانيًا ، بمجرد احتواء المنطقة بين الجينات على هياكل RNA متداخلة ومثبطة ، يتم التحكم في نسب مستوى التعبير عن بروتين الأوبون من خلال طاقات التكاثر (التي يتم قياسها بواسطة Δجياقتران) ، معدل الترجمة الأساسي (يحدده Δجيأخير - Δجيغير اقتران) ، ومعدل إعادة بدء الريبوسوم. منطقة بين الجينات ذات معدل ترجمة أساسي مرتفع (Δجيأخير - Δجيغير اقتران = −20 كيلو كالوري / مول) وبنية ضعيفة من الحمض النووي الريبي (Δجياقتران = −5 كيلو كالوري / مول) سيختلف الريبوسوم من جديد معدل البدء بمقدار 10 أضعاف مع زيادة معدلات ترجمة CDS المنبع (الشكل 6 أ). عندما تصبح بنية الحمض النووي الريبي أكثر استقرارًا ، ينخفض ​​معدل الترجمة القاعدية لـ CDS بشكل كبير وسيزداد فقط إذا تمت ترجمة CDS المنبع بدرجة عالية. من حيث المبدأ ، يمكن أن يؤدي الاقتران الترجمي إلى زيادة ترجمة CDS النهائية بمقدار 1000 ضعف إذا كان هيكل RNA المثبط مستقرًا للغاية وكشفًا تمامًا عن طريق استطالة الريبوسومات المنبع.

معلمات اقتران متعدية تتحكم في نسب البروتين. (أ) المعدلات المتوقعة لمعدلات ترجمة CDS المنبع والمصب كمنطقة جينية Δجياقتران الطاقة متنوعة. (ب) العلاقة المتوقعة بين نسب معدل الترجمة وجياقتران عندما (Δجيأخير - Δجيعدم-اقتران) هو 20 كيلو كالوري / مول. (ج) العلاقة المتوقعة بين نسب معدل الترجمة وجياقتران عندما (Δجيأخير - Δجيعدم-اقتران) هو −10 كيلو كالوري / مول. تمثل الدوائر والأشرطة متوسط ​​الانحرافات المعيارية للتنبؤات عند تقييمها عبر نطاق 10000 ضعف من معدلات ترجمة CDS المنبع.

معلمات اقتران متعدية تتحكم في نسب البروتين. (أ) المعدلات المتوقعة لمعدلات ترجمة CDS المنبع والمصب كمنطقة جينية Δجياقتران الطاقة متنوعة. (ب) العلاقة المتوقعة بين نسب معدل الترجمة وجياقتران عندما (Δجيأخير - Δجيعدم-اقتران) هو 20 كيلو كالوري / مول. (ج) العلاقة المتوقعة بين نسب معدل الترجمة وجياقتران عندما (Δجيأخير - Δجيعدم-اقتران) هو −10 كيلو كالوري / مول. تمثل الدوائر والأشرطة متوسط ​​الانحرافات المعيارية للتنبؤات عند تقييمها عبر نطاق 10000 ضعف من معدلات ترجمة CDS المنبع.

ثالثًا ، يمكن تصميم المناطق الجينية للحصول على نسب مستوى التعبير البروتيني المطلوبة عن طريق إدخال هياكل RNA المثبطة مع طاقات قابلة للطي مستهدفة. بالتفاوت Δجياقتران، مجموعة واسعة من نسب مستوى التعبير البروتين قابلة للتحقيق (الشكل 6 ب). على وجه الخصوص ، بمعدل ترجمة أساسي مرتفع (Δجيأخير - Δجيغير اقتران = −20 kcal / mol) ، يمكن ضبط نسب مستوى التعبير عن البروتين من ضعفين إلى 70 ضعفًا عند التعديل Δجياقتران من −5 إلى 30 كيلو كالوري / مول. عند تصميم مناطق جينية ذات معدل ترجمة أساسي منخفض بدلاً من ذلك (Δجيأخير - Δجيغير اقتران = −10 كيلو كالوري / مول) ، يتم تحقيق ضبط مماثل عند تغيير Δجياقتران من -1 إلى 15 كيلو كالوري / مول.


الملخص

غالبًا ما يقترن تخليق RNA الرسول البكتيري (mRNA) بواسطة RNA polymerase (RNAP) والترجمة الأولى بواسطة الريبوسوم لتنظيم التعبير الجيني ، ومع ذلك فإن كيفية إنشاء الاقتران والحفاظ عليه غير مفهوم. هنا ، نقوم بتطوير مناهج الفلورة البيوكيميائية وجزيء واحد لاستكشاف ديناميكيات تفاعلات RNAP مع الريبوسوم على mRNA مع ما قبل الترجمة.1-استشعار المحول الريبي في منطقته 5 غير المترجمة. تجليد preQ1 يؤدي إلى انسداد موقع ارتباط الريبوسوم (RBS) ، مما يعيق بدء الترجمة. نبرهن على أن RNAP في منطقة زعيم mRNA يعزز ارتباط الوحدة الفرعية للريبوسوم 30S ، مما يعادي preQ1بسبب انسداد RBS ، وأن عوامل النسخ التجسير RNAP-30S NusG و RfaH تعزز بشكل واضح تجنيد 30S والاحتفاظ بها ، على التوالي. وجدنا كذلك أنه في حين أن تفاعل 30S-mRNA يعوق بشكل كبير RNAP في غياب الترجمة ، فإن الريبوسوم المترجم بشكل نشط يعزز النسخ المنتج. يظهر نموذج حيث يتم تنسيق بنية mRNA وعوامل النسخ لتعديل كفاءة اقتران الترجمة والنسخ ديناميكيًا.


شاهد الفيديو: Bacterial Conjugation (شهر نوفمبر 2022).